Incidental Mutation 'R0344:Nup133'
ID26440
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Namenucleoporin 133
Synonymsmermaid, 4832420O05Rik
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123897123-123949265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123917446 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 727 (V727A)
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044795
AA Change: V727A

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: V727A

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213089
Meta Mutation Damage Score 0.256 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0139:Nup133 UTSW 8 123929343 missense probably benign 0.00
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1773:Nup133 UTSW 8 123930983 nonsense probably null
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2065:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4397:Nup133 UTSW 8 123944301 missense probably benign 0.04
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R5907:Nup133 UTSW 8 123916299 missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6059:Nup133 UTSW 8 123914596 missense probably damaging 1.00
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
R7101:Nup133 UTSW 8 123906227 missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123915373 missense probably benign 0.00
R7271:Nup133 UTSW 8 123922414 missense probably benign 0.34
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGAGAAAGGAACGGACTCCATT -3'
(R):5'- GGAGCCTTCATTGGCTTTTGTTAGACAT -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- tcccccaccccaaatacc -3'
Posted On2013-04-16