Incidental Mutation 'R3151:Tln2'
ID264413
Institutional Source Beutler Lab
Gene Symbol Tln2
Ensembl Gene ENSMUSG00000052698
Gene Nametalin 2
Synonyms
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R3151 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location67217087-67559703 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 67330547 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215267] [ENSMUST00000215784] [ENSMUST00000217550]
Predicted Effect probably null
Transcript: ENSMUST00000039662
SMART Domains Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 3.4e-59 PFAM
Pfam:I_LWEQ 661 765 1.9e-10 PFAM
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 2.6e-67 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2384 2531 2.5e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000040025
SMART Domains Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 8.5e-78 PFAM
low complexity region 674 693 N/A INTRINSIC
internal_repeat_2 703 763 2.05e-7 PROSPERO
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 9.9e-72 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2383 2533 4.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215267
Predicted Effect probably null
Transcript: ENSMUST00000215784
Predicted Effect probably null
Transcript: ENSMUST00000217550
Meta Mutation Damage Score 0.62 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Tln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tln2 APN 9 67344187 missense possibly damaging 0.59
IGL01110:Tln2 APN 9 67250582 nonsense probably null
IGL01112:Tln2 APN 9 67311811 missense probably damaging 1.00
IGL01307:Tln2 APN 9 67395467 missense probably benign 0.25
IGL01374:Tln2 APN 9 67261923 missense probably damaging 1.00
IGL01625:Tln2 APN 9 67370623 missense probably damaging 1.00
IGL01865:Tln2 APN 9 67250614 nonsense probably null
IGL01999:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02002:Tln2 APN 9 67356698 missense probably damaging 0.98
IGL02005:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02015:Tln2 APN 9 67361439 splice site probably benign
IGL02368:Tln2 APN 9 67240810 splice site probably benign
IGL02444:Tln2 APN 9 67258592 splice site probably benign
IGL02646:Tln2 APN 9 67255996 missense probably benign 0.43
IGL02744:Tln2 APN 9 67229376 nonsense probably null
IGL02869:Tln2 APN 9 67221525 splice site probably benign
IGL02930:Tln2 APN 9 67393662 nonsense probably null
IGL03100:Tln2 APN 9 67295737 missense probably damaging 1.00
IGL03326:Tln2 APN 9 67334257 missense possibly damaging 0.67
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0107:Tln2 UTSW 9 67370706 missense probably damaging 1.00
R0494:Tln2 UTSW 9 67355197 missense probably benign 0.22
R0884:Tln2 UTSW 9 67370733 missense probably damaging 1.00
R0947:Tln2 UTSW 9 67295813 missense probably benign 0.08
R0989:Tln2 UTSW 9 67229454 missense probably damaging 1.00
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1486:Tln2 UTSW 9 67311839 missense probably damaging 1.00
R1527:Tln2 UTSW 9 67272668 missense possibly damaging 0.95
R1584:Tln2 UTSW 9 67296414 missense probably damaging 1.00
R1636:Tln2 UTSW 9 67306532 missense probably damaging 1.00
R1656:Tln2 UTSW 9 67227107 missense possibly damaging 0.81
R1707:Tln2 UTSW 9 67375807 missense probably benign 0.00
R1749:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1751:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1761:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1767:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1815:Tln2 UTSW 9 67229423 missense probably damaging 1.00
R1840:Tln2 UTSW 9 67342043 missense probably damaging 1.00
R1847:Tln2 UTSW 9 67362687 nonsense probably null
R1964:Tln2 UTSW 9 67342135 missense probably benign 0.00
R1968:Tln2 UTSW 9 67255901 missense probably damaging 1.00
R2036:Tln2 UTSW 9 67272704 missense possibly damaging 0.76
R2038:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R2152:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2153:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2154:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2191:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2192:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2201:Tln2 UTSW 9 67375757 missense probably damaging 1.00
R3116:Tln2 UTSW 9 67355139 missense probably benign 0.10
R3795:Tln2 UTSW 9 67255915 missense probably damaging 0.97
R3953:Tln2 UTSW 9 67370629 missense probably damaging 1.00
R4450:Tln2 UTSW 9 67344065 critical splice donor site probably null
R4685:Tln2 UTSW 9 67302572 missense probably damaging 1.00
R4688:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R4696:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4697:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4700:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4701:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4741:Tln2 UTSW 9 67386555 critical splice donor site probably null
R4806:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4807:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4808:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4967:Tln2 UTSW 9 67355125 missense probably damaging 0.97
R5061:Tln2 UTSW 9 67354468 missense probably benign
R5092:Tln2 UTSW 9 67256028 missense probably benign 0.13
R5093:Tln2 UTSW 9 67334314 missense probably benign 0.44
R5126:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R5204:Tln2 UTSW 9 67354482 missense probably benign 0.00
R5236:Tln2 UTSW 9 67365923 missense probably damaging 0.99
R5287:Tln2 UTSW 9 67242359 missense probably damaging 1.00
R5568:Tln2 UTSW 9 67311865 missense probably damaging 1.00
R5571:Tln2 UTSW 9 67334320 missense possibly damaging 0.88
R5642:Tln2 UTSW 9 67296358 missense probably benign 0.01
R5711:Tln2 UTSW 9 67392547 missense probably benign 0.00
R5776:Tln2 UTSW 9 67258250 missense probably damaging 1.00
R5791:Tln2 UTSW 9 67386605 missense probably damaging 0.98
R5866:Tln2 UTSW 9 67266868 missense probably damaging 1.00
R5888:Tln2 UTSW 9 67229403 missense probably damaging 1.00
R5902:Tln2 UTSW 9 67362717 missense probably benign 0.02
R6106:Tln2 UTSW 9 67323020 missense probably damaging 0.99
R6175:Tln2 UTSW 9 67224081 missense probably damaging 1.00
R6385:Tln2 UTSW 9 67278129 missense probably benign 0.45
R6430:Tln2 UTSW 9 67272665 missense probably damaging 1.00
R6441:Tln2 UTSW 9 67272689 missense probably damaging 1.00
R6738:Tln2 UTSW 9 67386664 missense possibly damaging 0.91
R6776:Tln2 UTSW 9 67262905 missense probably damaging 1.00
R6794:Tln2 UTSW 9 67286558 missense probably benign 0.07
R6850:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R6907:Tln2 UTSW 9 67397635 missense probably damaging 0.98
R6909:Tln2 UTSW 9 67392532 missense probably damaging 0.97
R6951:Tln2 UTSW 9 67258485 missense probably damaging 0.97
X0027:Tln2 UTSW 9 67376853 missense probably damaging 1.00
X0064:Tln2 UTSW 9 67348138 missense probably damaging 1.00
X0067:Tln2 UTSW 9 67370691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGTCGGAGGAAGTAAGCCC -3'
(R):5'- TGCCCTAAGACCTCGGAGATTG -3'

Sequencing Primer
(F):5'- GATGCTGCCTTAAACTATGAGCC -3'
(R):5'- AAAAGTGTGCTCAGGACC -3'
Posted On2015-02-05