Incidental Mutation 'R0344:Sik3'
ID26443
Institutional Source Beutler Lab
Gene Symbol Sik3
Ensembl Gene ENSMUSG00000034135
Gene NameSIK family kinase 3
Synonyms
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location46012820-46224194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46208811 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 683 (Q683K)
Ref Sequence ENSEMBL: ENSMUSP00000112749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120463] [ENSMUST00000126865]
Predicted Effect unknown
Transcript: ENSMUST00000120247
AA Change: Q637K
SMART Domains Protein: ENSMUSP00000112859
Gene: ENSMUSG00000034135
AA Change: Q637K

DomainStartEndE-ValueType
S_TKc 19 270 5.4e-102 SMART
internal_repeat_1 349 392 8.97e-6 PROSPERO
low complexity region 436 445 N/A INTRINSIC
internal_repeat_1 492 536 8.97e-6 PROSPERO
low complexity region 602 613 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120463
AA Change: Q683K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112749
Gene: ENSMUSG00000034135
AA Change: Q683K

DomainStartEndE-ValueType
low complexity region 1 53 N/A INTRINSIC
S_TKc 64 315 5.4e-102 SMART
low complexity region 529 538 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
low complexity region 673 693 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 830 843 N/A INTRINSIC
low complexity region 894 907 N/A INTRINSIC
low complexity region 996 1011 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126865
AA Change: Q733K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121032
Gene: ENSMUSG00000034135
AA Change: Q733K

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
S_TKc 66 317 5.4e-102 SMART
internal_repeat_1 444 487 1.55e-6 PROSPERO
low complexity region 531 540 N/A INTRINSIC
internal_repeat_1 587 631 1.55e-6 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 723 743 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 880 893 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1046 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153152
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired chondrocyte hypertrophy during development, neonatal lethality and reduced size. Mice homozygous for a gain of function ENU mutation exhibit decreased total wake time, owing to an increase in inherent sleep need. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Sik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Sik3 APN 9 46211726 missense probably benign 0.37
IGL02957:Sik3 APN 9 46195845 missense possibly damaging 0.90
IGL03052:Sik3 UTSW 9 46198149 missense probably damaging 0.97
PIT4515001:Sik3 UTSW 9 46208731 missense probably damaging 1.00
R0119:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0299:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0411:Sik3 UTSW 9 46208770 missense probably damaging 0.99
R0499:Sik3 UTSW 9 46208740 missense possibly damaging 0.81
R0745:Sik3 UTSW 9 46198239 missense probably benign 0.10
R1017:Sik3 UTSW 9 46195809 missense probably benign 0.00
R1310:Sik3 UTSW 9 46219426 missense possibly damaging 0.81
R1355:Sik3 UTSW 9 46195872 critical splice donor site probably benign
R1406:Sik3 UTSW 9 46123345 splice site probably benign
R1457:Sik3 UTSW 9 46221148 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46202022 missense probably damaging 1.00
R1497:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1852:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1883:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1884:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1903:Sik3 UTSW 9 46221089 missense probably benign 0.00
R1918:Sik3 UTSW 9 46221089 missense probably benign 0.00
R2077:Sik3 UTSW 9 46219503 missense probably damaging 1.00
R2379:Sik3 UTSW 9 46155409 missense probably damaging 1.00
R3791:Sik3 UTSW 9 46194822 missense possibly damaging 0.94
R3809:Sik3 UTSW 9 46219486 missense probably benign 0.05
R3955:Sik3 UTSW 9 46198593 missense probably damaging 1.00
R3980:Sik3 UTSW 9 46202063 missense probably damaging 1.00
R4753:Sik3 UTSW 9 46198214 missense probably damaging 0.99
R5195:Sik3 UTSW 9 46208844 critical splice donor site probably null
R5256:Sik3 UTSW 9 46212254 missense probably damaging 0.99
R5432:Sik3 UTSW 9 46123241 missense probably benign 0.45
R5985:Sik3 UTSW 9 46211675 missense probably damaging 1.00
R6310:Sik3 UTSW 9 46178486 missense probably damaging 1.00
R6540:Sik3 UTSW 9 46212053 missense probably benign
R6732:Sik3 UTSW 9 46212553 missense probably benign 0.02
R6812:Sik3 UTSW 9 46210769 missense probably damaging 1.00
R7069:Sik3 UTSW 9 46210743 missense probably damaging 1.00
X0017:Sik3 UTSW 9 46212499 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATTCCACACTGGGCATTCCAC -3'
(R):5'- ATCGTGAGCTACGAAAGGCATTAGG -3'

Sequencing Primer
(F):5'- GGCATTCCACAGTGTGTCC -3'
(R):5'- CTACGAAAGGCATTAGGGCTATTC -3'
Posted On2013-04-16