Incidental Mutation 'R3151:Fads3'
ID264436
Institutional Source Beutler Lab
Gene Symbol Fads3
Ensembl Gene ENSMUSG00000024664
Gene Namefatty acid desaturase 3
Synonyms
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3151 (G1)
Quality Score168
Status Validated
Chromosome19
Chromosomal Location10041548-10059671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 10057898 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 438 (S438A)
Ref Sequence ENSEMBL: ENSMUSP00000111659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115995]
Predicted Effect probably benign
Transcript: ENSMUST00000115995
AA Change: S438A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000111659
Gene: ENSMUSG00000024664
AA Change: S438A

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Cyt-b5 27 101 6.21e-16 SMART
Pfam:FA_desaturase 162 423 4.1e-35 PFAM
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout affects highly unsaturated fatty acid levels in the liver and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Tln2 C T 9: 67,330,547 probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Fads3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fads3 APN 19 10052299 missense probably null 0.98
IGL00422:Fads3 APN 19 10055681 missense possibly damaging 0.80
IGL01081:Fads3 APN 19 10053002 missense probably benign 0.00
IGL02454:Fads3 APN 19 10055119 missense probably damaging 0.97
IGL02477:Fads3 APN 19 10056442 missense probably damaging 1.00
R0611:Fads3 UTSW 19 10041836 missense probably damaging 1.00
R1169:Fads3 UTSW 19 10054099 missense possibly damaging 0.82
R1400:Fads3 UTSW 19 10056300 splice site probably null
R1893:Fads3 UTSW 19 10056504 missense probably benign
R2508:Fads3 UTSW 19 10056454 missense probably damaging 1.00
R4543:Fads3 UTSW 19 10041811 missense possibly damaging 0.60
R4766:Fads3 UTSW 19 10056020 missense possibly damaging 0.94
R4823:Fads3 UTSW 19 10041888 missense probably damaging 0.98
R5117:Fads3 UTSW 19 10041958 critical splice donor site probably null
R5846:Fads3 UTSW 19 10053033 missense probably null 1.00
R6117:Fads3 UTSW 19 10054267 missense probably damaging 1.00
R6225:Fads3 UTSW 19 10041838 missense probably benign 0.25
X0027:Fads3 UTSW 19 10054250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTCCAGATTCCACTCTG -3'
(R):5'- TTGCTGACCAGAAAATGCTGAG -3'

Sequencing Primer
(F):5'- GGTTAATGAGTACCTGGCCTCAC -3'
(R):5'- CTGACCAGAAAATGCTGAGGACTG -3'
Posted On2015-02-05