Incidental Mutation 'R3153:Slitrk3'
ID264447
Institutional Source Beutler Lab
Gene Symbol Slitrk3
Ensembl Gene ENSMUSG00000048304
Gene NameSLIT and NTRK-like family, member 3
Synonyms
MMRRC Submission 040604-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R3153 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location73047265-73057803 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 73048982 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 819 (W819*)
Ref Sequence ENSEMBL: ENSMUSP00000141236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]
Predicted Effect probably null
Transcript: ENSMUST00000059407
AA Change: W819*
SMART Domains Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: W819*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000192477
AA Change: W819*
SMART Domains Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: W819*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Abhd12 A G 2: 150,834,355 F361L probably benign Het
Abr A T 11: 76,486,469 I59N probably damaging Het
Agbl1 A G 7: 76,720,196 E681G probably damaging Het
B3gnt4 G T 5: 123,510,653 R27L probably benign Het
Cct8l1 A C 5: 25,517,139 E284A probably damaging Het
Chd7 T A 4: 8,855,174 N2134K probably benign Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cndp2 C A 18: 84,668,597 M433I probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Col20a1 C T 2: 181,008,593 P1074L probably damaging Het
Coq6 G A 12: 84,371,535 V298M probably damaging Het
Cpt1a A G 19: 3,356,430 Y132C probably damaging Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Eps8l1 A T 7: 4,471,799 I321F probably damaging Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fcrl5 T C 3: 87,443,680 F166L probably benign Het
Gatc T C 5: 115,335,487 E131G probably benign Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gprc5b G A 7: 118,976,547 P385L probably damaging Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Hsd3b1 T C 3: 98,852,664 D337G probably damaging Het
Ireb2 T C 9: 54,885,946 probably null Het
Kank1 T A 19: 25,410,688 V575E possibly damaging Het
Kcnmb1 A T 11: 33,966,339 D95V probably damaging Het
L3mbtl4 T A 17: 68,457,248 Y125* probably null Het
Lce1h C T 3: 92,763,675 G57R unknown Het
Lgalsl A G 11: 20,826,487 F135S probably damaging Het
Lrba A G 3: 86,285,219 M147V probably damaging Het
Mdm2 T C 10: 117,709,713 E23G possibly damaging Het
Mthfd1 C A 12: 76,311,963 Q67K probably benign Het
Mtus2 T C 5: 148,083,060 L755P probably damaging Het
Olfr1026 T C 2: 85,923,730 V154A probably benign Het
Orc3 A G 4: 34,575,124 F587L probably damaging Het
Pcdhb7 C T 18: 37,343,073 P421S probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Pkd1l1 A C 11: 8,867,207 S1364A probably benign Het
Rin3 A C 12: 102,368,541 E157A unknown Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Rph3a T C 5: 120,973,377 T47A probably damaging Het
Sap18 T C 14: 57,801,945 M68T probably benign Het
Sfrp2 A G 3: 83,773,270 T246A probably benign Het
Slc18a3 A G 14: 32,463,271 V385A probably benign Het
Smap1 A T 1: 23,853,549 D111E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Sv2a T A 3: 96,185,258 D91E possibly damaging Het
Tbc1d5 A G 17: 50,968,236 I77T probably damaging Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Zbtb38 T C 9: 96,688,249 K261E probably benign Het
Zfp202 T C 9: 40,208,438 L179P probably benign Het
Zkscan5 T A 5: 145,212,627 S251R probably benign Het
Other mutations in Slitrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slitrk3 APN 3 73051103 missense probably damaging 1.00
IGL00857:Slitrk3 APN 3 73049841 missense probably damaging 1.00
IGL00990:Slitrk3 APN 3 73050081 missense probably damaging 1.00
IGL01010:Slitrk3 APN 3 73049273 missense probably benign 0.14
IGL01299:Slitrk3 APN 3 73049016 missense probably benign 0.43
IGL01609:Slitrk3 APN 3 73050237 missense probably damaging 1.00
IGL01881:Slitrk3 APN 3 73049306 missense probably benign 0.00
IGL01941:Slitrk3 APN 3 73051071 missense possibly damaging 0.72
IGL02183:Slitrk3 APN 3 73049979 missense probably damaging 0.97
IGL02187:Slitrk3 APN 3 73050272 missense probably damaging 1.00
IGL02478:Slitrk3 APN 3 73050713 missense probably damaging 0.96
IGL02512:Slitrk3 APN 3 73050402 missense probably benign 0.28
IGL02720:Slitrk3 APN 3 73050768 missense probably damaging 1.00
IGL03113:Slitrk3 APN 3 73050390 missense probably benign 0.00
IGL03224:Slitrk3 APN 3 73049930 missense possibly damaging 0.72
wee UTSW 3 73050785 missense probably damaging 1.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0639:Slitrk3 UTSW 3 73049649 missense probably benign 0.02
R1448:Slitrk3 UTSW 3 73050341 missense probably damaging 0.99
R1656:Slitrk3 UTSW 3 73050339 missense probably damaging 0.98
R1713:Slitrk3 UTSW 3 73049691 missense probably benign 0.00
R1992:Slitrk3 UTSW 3 73049771 missense possibly damaging 0.80
R1999:Slitrk3 UTSW 3 73049964 missense probably benign 0.13
R2359:Slitrk3 UTSW 3 73049345 missense possibly damaging 0.56
R3083:Slitrk3 UTSW 3 73048595 missense probably benign 0.00
R3821:Slitrk3 UTSW 3 73049216 missense possibly damaging 0.94
R4208:Slitrk3 UTSW 3 73051157 missense possibly damaging 0.67
R4323:Slitrk3 UTSW 3 73050785 missense probably damaging 1.00
R4580:Slitrk3 UTSW 3 73051206 missense probably damaging 0.96
R4730:Slitrk3 UTSW 3 73049519 missense probably benign 0.08
R4742:Slitrk3 UTSW 3 73048565 missense probably benign 0.00
R4979:Slitrk3 UTSW 3 73049796 missense possibly damaging 0.95
R5018:Slitrk3 UTSW 3 73050512 missense probably benign 0.31
R5023:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5057:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5156:Slitrk3 UTSW 3 73049259 missense probably benign
R5500:Slitrk3 UTSW 3 73050347 missense probably damaging 1.00
R5582:Slitrk3 UTSW 3 73050404 missense probably benign 0.09
R5797:Slitrk3 UTSW 3 73048629 missense probably damaging 0.99
R5963:Slitrk3 UTSW 3 73050713 missense probably benign 0.30
R5985:Slitrk3 UTSW 3 73050900 missense probably damaging 1.00
R6123:Slitrk3 UTSW 3 73049762 missense probably damaging 1.00
R6393:Slitrk3 UTSW 3 73049914 missense possibly damaging 0.79
R6529:Slitrk3 UTSW 3 73051218 missense probably benign 0.02
R6584:Slitrk3 UTSW 3 73049225 missense probably damaging 0.99
R6645:Slitrk3 UTSW 3 73049861 missense probably benign 0.13
R7001:Slitrk3 UTSW 3 73050609 nonsense probably null
R7282:Slitrk3 UTSW 3 73050465 missense possibly damaging 0.70
R7534:Slitrk3 UTSW 3 73050107 missense probably damaging 0.98
X0022:Slitrk3 UTSW 3 73050266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTAGTAGCAGACTGCCAC -3'
(R):5'- CCCCATCTATAAGCCTCGAGAG -3'

Sequencing Primer
(F):5'- TAGCAGACTGCCACCACCAC -3'
(R):5'- GGAGGAAGAAGTGGCTGCC -3'
Posted On2015-02-05