Incidental Mutation 'R3153:Zfp202'
ID264472
Institutional Source Beutler Lab
Gene Symbol Zfp202
Ensembl Gene ENSMUSG00000025602
Gene Namezinc finger protein 202
SynonymsC130037E22Rik
MMRRC Submission 040604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3153 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location40192316-40213604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40208438 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 179 (L179P)
Ref Sequence ENSEMBL: ENSMUSP00000132131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026693] [ENSMUST00000168691] [ENSMUST00000168832]
Predicted Effect probably benign
Transcript: ENSMUST00000026693
AA Change: L179P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026693
Gene: ENSMUSG00000025602
AA Change: L179P

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 297 1.7e-17 SMART
ZnF_C2H2 391 413 9.44e-2 SMART
ZnF_C2H2 419 441 6.42e-4 SMART
ZnF_C2H2 473 495 3.44e-4 SMART
ZnF_C2H2 501 523 1.47e-3 SMART
ZnF_C2H2 529 551 1.64e-1 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 8.47e-4 SMART
ZnF_C2H2 613 635 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168691
SMART Domains Protein: ENSMUSP00000130163
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 132 1.03e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168832
AA Change: L179P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132131
Gene: ENSMUSG00000025602
AA Change: L179P

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 277 5.32e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Abhd12 A G 2: 150,834,355 F361L probably benign Het
Abr A T 11: 76,486,469 I59N probably damaging Het
Agbl1 A G 7: 76,720,196 E681G probably damaging Het
B3gnt4 G T 5: 123,510,653 R27L probably benign Het
Cct8l1 A C 5: 25,517,139 E284A probably damaging Het
Chd7 T A 4: 8,855,174 N2134K probably benign Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cndp2 C A 18: 84,668,597 M433I probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Col20a1 C T 2: 181,008,593 P1074L probably damaging Het
Coq6 G A 12: 84,371,535 V298M probably damaging Het
Cpt1a A G 19: 3,356,430 Y132C probably damaging Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Eps8l1 A T 7: 4,471,799 I321F probably damaging Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fcrl5 T C 3: 87,443,680 F166L probably benign Het
Gatc T C 5: 115,335,487 E131G probably benign Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gprc5b G A 7: 118,976,547 P385L probably damaging Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Hsd3b1 T C 3: 98,852,664 D337G probably damaging Het
Ireb2 T C 9: 54,885,946 probably null Het
Kank1 T A 19: 25,410,688 V575E possibly damaging Het
Kcnmb1 A T 11: 33,966,339 D95V probably damaging Het
L3mbtl4 T A 17: 68,457,248 Y125* probably null Het
Lce1h C T 3: 92,763,675 G57R unknown Het
Lgalsl A G 11: 20,826,487 F135S probably damaging Het
Lrba A G 3: 86,285,219 M147V probably damaging Het
Mdm2 T C 10: 117,709,713 E23G possibly damaging Het
Mthfd1 C A 12: 76,311,963 Q67K probably benign Het
Mtus2 T C 5: 148,083,060 L755P probably damaging Het
Olfr1026 T C 2: 85,923,730 V154A probably benign Het
Orc3 A G 4: 34,575,124 F587L probably damaging Het
Pcdhb7 C T 18: 37,343,073 P421S probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Pkd1l1 A C 11: 8,867,207 S1364A probably benign Het
Rin3 A C 12: 102,368,541 E157A unknown Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Rph3a T C 5: 120,973,377 T47A probably damaging Het
Sap18 T C 14: 57,801,945 M68T probably benign Het
Sfrp2 A G 3: 83,773,270 T246A probably benign Het
Slc18a3 A G 14: 32,463,271 V385A probably benign Het
Slitrk3 C T 3: 73,048,982 W819* probably null Het
Smap1 A T 1: 23,853,549 D111E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Sv2a T A 3: 96,185,258 D91E possibly damaging Het
Tbc1d5 A G 17: 50,968,236 I77T probably damaging Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Zbtb38 T C 9: 96,688,249 K261E probably benign Het
Zkscan5 T A 5: 145,212,627 S251R probably benign Het
Other mutations in Zfp202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Zfp202 APN 9 40211043 missense probably benign 0.02
IGL01862:Zfp202 APN 9 40211828 missense probably benign 0.39
IGL03069:Zfp202 APN 9 40211399 missense probably damaging 1.00
R0028:Zfp202 UTSW 9 40211752 missense probably damaging 1.00
R0158:Zfp202 UTSW 9 40208916 nonsense probably null
R0278:Zfp202 UTSW 9 40208482 missense probably benign 0.15
R1132:Zfp202 UTSW 9 40211022 missense probably benign 0.00
R1404:Zfp202 UTSW 9 40211496 missense probably damaging 1.00
R1404:Zfp202 UTSW 9 40211496 missense probably damaging 1.00
R1764:Zfp202 UTSW 9 40210466 missense probably benign 0.00
R1928:Zfp202 UTSW 9 40209787 missense probably damaging 1.00
R2929:Zfp202 UTSW 9 40211688 missense possibly damaging 0.94
R3948:Zfp202 UTSW 9 40208425 missense probably benign 0.43
R4190:Zfp202 UTSW 9 40211337 missense probably benign 0.00
R4273:Zfp202 UTSW 9 40207494 nonsense probably null
R6181:Zfp202 UTSW 9 40207342 missense probably damaging 1.00
R6182:Zfp202 UTSW 9 40207342 missense probably damaging 1.00
R6816:Zfp202 UTSW 9 40211813 missense probably damaging 1.00
R6835:Zfp202 UTSW 9 40210235 intron probably null
R7382:Zfp202 UTSW 9 40211505 missense probably damaging 1.00
R7493:Zfp202 UTSW 9 40207344 missense possibly damaging 0.57
R7542:Zfp202 UTSW 9 40211147 missense probably benign 0.12
X0012:Zfp202 UTSW 9 40211184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTGACTCCATCATGACTGG -3'
(R):5'- CCATTTGTAGGCAGGTTCTAGC -3'

Sequencing Primer
(F):5'- GACTGGAAGTTAAAATTGTTCCCAGG -3'
(R):5'- AGCTGGTCGTGTTCTCAGCATC -3'
Posted On2015-02-05