Incidental Mutation 'R3153:Gsc2'
ID264492
Institutional Source Beutler Lab
Gene Symbol Gsc2
Ensembl Gene ENSMUSG00000022738
Gene Namegoosecoid homebox 2
SynonymsGscl, 4930568H22Rik
MMRRC Submission 040604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3153 (G1)
Quality Score163
Status Not validated
Chromosome16
Chromosomal Location17913107-17915059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17914500 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 137 (R137W)
Ref Sequence ENSEMBL: ENSMUSP00000155932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003621] [ENSMUST00000012279] [ENSMUST00000232423] [ENSMUST00000232493]
Predicted Effect probably benign
Transcript: ENSMUST00000003621
SMART Domains Protein: ENSMUSP00000003621
Gene: ENSMUSG00000003527

DomainStartEndE-ValueType
low complexity region 7 34 N/A INTRINSIC
Pfam:Es2 37 405 1.9e-76 PFAM
low complexity region 434 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000012279
AA Change: R124W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012279
Gene: ENSMUSG00000022738
AA Change: R124W

DomainStartEndE-ValueType
low complexity region 59 85 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
HOX 136 198 2.9e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232423
Predicted Effect probably damaging
Transcript: ENSMUST00000232493
AA Change: R137W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Goosecoidlike (GSCL), a homeodomain-containing gene, resides in the critical region for VCFS/DGS on 22q11. Velocardiofacial syndrome (VCFS) is a developmental disorder characterized by conotruncal heart defects, craniofacial anomalies, and learning disabilities. VCFS is phenotypically related to DiGeorge syndrome (DGS) and both syndromes are associated with hemizygous 22q11 deletions. Because many of the tissues and structures affected in VCFS/DGS derive from the pharyngeal arches of the developing embryo, it is believed that haploinsufficiency of a gene involved in embryonic development may be responsible for its etiology. The gene is expressed in a limited number of adult tissues, as well as in early human development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either one of two independently generated knock-out alleles are viable and fertile with no detectable anatomical or histological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Abhd12 A G 2: 150,834,355 F361L probably benign Het
Abr A T 11: 76,486,469 I59N probably damaging Het
Agbl1 A G 7: 76,720,196 E681G probably damaging Het
B3gnt4 G T 5: 123,510,653 R27L probably benign Het
Cct8l1 A C 5: 25,517,139 E284A probably damaging Het
Chd7 T A 4: 8,855,174 N2134K probably benign Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cndp2 C A 18: 84,668,597 M433I probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Col20a1 C T 2: 181,008,593 P1074L probably damaging Het
Coq6 G A 12: 84,371,535 V298M probably damaging Het
Cpt1a A G 19: 3,356,430 Y132C probably damaging Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Eps8l1 A T 7: 4,471,799 I321F probably damaging Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fcrl5 T C 3: 87,443,680 F166L probably benign Het
Gatc T C 5: 115,335,487 E131G probably benign Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gprc5b G A 7: 118,976,547 P385L probably damaging Het
Hsd3b1 T C 3: 98,852,664 D337G probably damaging Het
Ireb2 T C 9: 54,885,946 probably null Het
Kank1 T A 19: 25,410,688 V575E possibly damaging Het
Kcnmb1 A T 11: 33,966,339 D95V probably damaging Het
L3mbtl4 T A 17: 68,457,248 Y125* probably null Het
Lce1h C T 3: 92,763,675 G57R unknown Het
Lgalsl A G 11: 20,826,487 F135S probably damaging Het
Lrba A G 3: 86,285,219 M147V probably damaging Het
Mdm2 T C 10: 117,709,713 E23G possibly damaging Het
Mthfd1 C A 12: 76,311,963 Q67K probably benign Het
Mtus2 T C 5: 148,083,060 L755P probably damaging Het
Olfr1026 T C 2: 85,923,730 V154A probably benign Het
Orc3 A G 4: 34,575,124 F587L probably damaging Het
Pcdhb7 C T 18: 37,343,073 P421S probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Pkd1l1 A C 11: 8,867,207 S1364A probably benign Het
Rin3 A C 12: 102,368,541 E157A unknown Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Rph3a T C 5: 120,973,377 T47A probably damaging Het
Sap18 T C 14: 57,801,945 M68T probably benign Het
Sfrp2 A G 3: 83,773,270 T246A probably benign Het
Slc18a3 A G 14: 32,463,271 V385A probably benign Het
Slitrk3 C T 3: 73,048,982 W819* probably null Het
Smap1 A T 1: 23,853,549 D111E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Sv2a T A 3: 96,185,258 D91E possibly damaging Het
Tbc1d5 A G 17: 50,968,236 I77T probably damaging Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Zbtb38 T C 9: 96,688,249 K261E probably benign Het
Zfp202 T C 9: 40,208,438 L179P probably benign Het
Zkscan5 T A 5: 145,212,627 S251R probably benign Het
Other mutations in Gsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3035:Gsc2 UTSW 16 17914928 missense probably damaging 0.99
R3154:Gsc2 UTSW 16 17914500 missense probably damaging 1.00
R4154:Gsc2 UTSW 16 17914802 small deletion probably benign
R6182:Gsc2 UTSW 16 17913619 makesense probably null
R6962:Gsc2 UTSW 16 17915038 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTTGAAGCCCCTTCTGGAAG -3'
(R):5'- ATCGAGCACATCCTCTCCAG -3'

Sequencing Primer
(F):5'- TCTTTGAAAAATAAGAGTGGCGCC -3'
(R):5'- CAAGACTAGGCGGGGATCTC -3'
Posted On2015-02-05