Incidental Mutation 'R3153:Trim10'
ID264496
Institutional Source Beutler Lab
Gene Symbol Trim10
Ensembl Gene ENSMUSG00000073400
Gene Nametripartite motif-containing 10
SynonymsRnf9, Herf1
MMRRC Submission 040604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R3153 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36869574-36877833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36871688 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 149 (C149S)
Ref Sequence ENSEMBL: ENSMUSP00000057928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025329] [ENSMUST00000060524] [ENSMUST00000174195]
Predicted Effect probably benign
Transcript: ENSMUST00000025329
SMART Domains Protein: ENSMUSP00000025329
Gene: ENSMUSG00000050747

DomainStartEndE-ValueType
RING 15 53 2e-4 SMART
BBOX 73 114 2.41e-12 SMART
coiled coil region 145 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000060524
AA Change: C149S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057928
Gene: ENSMUSG00000073400
AA Change: C149S

DomainStartEndE-ValueType
RING 16 60 1.2e-7 SMART
BBOX 94 135 5.38e-10 SMART
coiled coil region 152 175 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
PRY 309 361 1.04e-25 SMART
SPRY 362 485 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173639
SMART Domains Protein: ENSMUSP00000133638
Gene: ENSMUSG00000050747

DomainStartEndE-ValueType
SCOP:d1dkza_ 15 105 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174195
SMART Domains Protein: ENSMUSP00000133953
Gene: ENSMUSG00000050747

DomainStartEndE-ValueType
RING 15 53 2e-4 SMART
BBOX 73 114 2.41e-12 SMART
coiled coil region 145 229 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic bodies. Studies in mice suggest that this protein plays a role in terminal differentiation of erythroid cells. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Abhd12 A G 2: 150,834,355 F361L probably benign Het
Abr A T 11: 76,486,469 I59N probably damaging Het
Agbl1 A G 7: 76,720,196 E681G probably damaging Het
B3gnt4 G T 5: 123,510,653 R27L probably benign Het
Cct8l1 A C 5: 25,517,139 E284A probably damaging Het
Chd7 T A 4: 8,855,174 N2134K probably benign Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cndp2 C A 18: 84,668,597 M433I probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Col20a1 C T 2: 181,008,593 P1074L probably damaging Het
Coq6 G A 12: 84,371,535 V298M probably damaging Het
Cpt1a A G 19: 3,356,430 Y132C probably damaging Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Eps8l1 A T 7: 4,471,799 I321F probably damaging Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fcrl5 T C 3: 87,443,680 F166L probably benign Het
Gatc T C 5: 115,335,487 E131G probably benign Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gprc5b G A 7: 118,976,547 P385L probably damaging Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Hsd3b1 T C 3: 98,852,664 D337G probably damaging Het
Ireb2 T C 9: 54,885,946 probably null Het
Kank1 T A 19: 25,410,688 V575E possibly damaging Het
Kcnmb1 A T 11: 33,966,339 D95V probably damaging Het
L3mbtl4 T A 17: 68,457,248 Y125* probably null Het
Lce1h C T 3: 92,763,675 G57R unknown Het
Lgalsl A G 11: 20,826,487 F135S probably damaging Het
Lrba A G 3: 86,285,219 M147V probably damaging Het
Mdm2 T C 10: 117,709,713 E23G possibly damaging Het
Mthfd1 C A 12: 76,311,963 Q67K probably benign Het
Mtus2 T C 5: 148,083,060 L755P probably damaging Het
Olfr1026 T C 2: 85,923,730 V154A probably benign Het
Orc3 A G 4: 34,575,124 F587L probably damaging Het
Pcdhb7 C T 18: 37,343,073 P421S probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Pkd1l1 A C 11: 8,867,207 S1364A probably benign Het
Rin3 A C 12: 102,368,541 E157A unknown Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Rph3a T C 5: 120,973,377 T47A probably damaging Het
Sap18 T C 14: 57,801,945 M68T probably benign Het
Sfrp2 A G 3: 83,773,270 T246A probably benign Het
Slc18a3 A G 14: 32,463,271 V385A probably benign Het
Slitrk3 C T 3: 73,048,982 W819* probably null Het
Smap1 A T 1: 23,853,549 D111E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Sv2a T A 3: 96,185,258 D91E possibly damaging Het
Tbc1d5 A G 17: 50,968,236 I77T probably damaging Het
Zbtb38 T C 9: 96,688,249 K261E probably benign Het
Zfp202 T C 9: 40,208,438 L179P probably benign Het
Zkscan5 T A 5: 145,212,627 S251R probably benign Het
Other mutations in Trim10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Trim10 APN 17 36877248 missense probably benign 0.03
IGL00501:Trim10 APN 17 36877047 missense probably benign 0.08
IGL00846:Trim10 APN 17 36871692 missense probably damaging 1.00
IGL01536:Trim10 APN 17 36877288 unclassified probably null
IGL02814:Trim10 APN 17 36877336 nonsense probably null
IGL03135:Trim10 APN 17 36874221 missense possibly damaging 0.78
IGL03144:Trim10 APN 17 36876848 missense probably damaging 1.00
IGL03298:Trim10 APN 17 36877025 missense possibly damaging 0.87
PIT4378001:Trim10 UTSW 17 36877128 missense probably damaging 0.98
R0102:Trim10 UTSW 17 36870182 missense probably damaging 1.00
R0102:Trim10 UTSW 17 36870182 missense probably damaging 1.00
R0834:Trim10 UTSW 17 36872391 missense probably benign 0.00
R1517:Trim10 UTSW 17 36872454 missense probably damaging 1.00
R1691:Trim10 UTSW 17 36876899 missense probably damaging 1.00
R1696:Trim10 UTSW 17 36877181 nonsense probably null
R2149:Trim10 UTSW 17 36877014 missense probably benign 0.18
R3154:Trim10 UTSW 17 36871688 missense probably damaging 1.00
R5156:Trim10 UTSW 17 36877056 missense probably damaging 0.99
R5327:Trim10 UTSW 17 36870189 missense probably damaging 1.00
R5361:Trim10 UTSW 17 36875436 missense probably benign 0.03
R5758:Trim10 UTSW 17 36877152 missense possibly damaging 0.80
R5764:Trim10 UTSW 17 36870181 missense probably damaging 0.97
R6032:Trim10 UTSW 17 36871714 missense possibly damaging 0.87
R6032:Trim10 UTSW 17 36871714 missense possibly damaging 0.87
R6179:Trim10 UTSW 17 36877031 missense probably damaging 1.00
R6709:Trim10 UTSW 17 36872370 missense probably damaging 0.99
R7172:Trim10 UTSW 17 36870063 missense possibly damaging 0.78
R7197:Trim10 UTSW 17 36876954 missense probably damaging 1.00
R7390:Trim10 UTSW 17 36869881 start codon destroyed probably null 0.98
R7391:Trim10 UTSW 17 36869881 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- CCCTGCTCAAAATCTCTAGGAC -3'
(R):5'- CAGGATTCCGATTCAGAGAGCTC -3'

Sequencing Primer
(F):5'- GTAAGCCTGGACTACATGAGATCC -3'
(R):5'- GATTCAGAGAGCTCCACGTCTCTG -3'
Posted On2015-02-05