Incidental Mutation 'R0344:Itgae'
ID26450
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Nameintegrin alpha E, epithelial-associated
SynonymsCD103, alpha-E1
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73090583-73147446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73118147 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 485 (K485E)
Ref Sequence ENSEMBL: ENSMUSP00000099596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
Predicted Effect probably benign
Transcript: ENSMUST00000006101
AA Change: K485E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: K485E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102537
AA Change: K485E

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: K485E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Meta Mutation Damage Score 0.01 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73145635 missense probably benign 0.17
IGL00472:Itgae APN 11 73113694 missense probably benign 0.06
IGL00821:Itgae APN 11 73123148 missense probably damaging 1.00
IGL01625:Itgae APN 11 73119437 missense probably benign 0.00
IGL01639:Itgae APN 11 73119378 missense probably benign 0.00
IGL01743:Itgae APN 11 73111759 missense probably benign 0.02
IGL01911:Itgae APN 11 73116137 missense probably damaging 1.00
IGL01949:Itgae APN 11 73118184 missense probably benign 0.29
IGL02149:Itgae APN 11 73103894 missense probably benign 0.04
IGL02179:Itgae APN 11 73134018 missense probably benign 0.06
IGL02231:Itgae APN 11 73090622 missense possibly damaging 0.88
IGL02292:Itgae APN 11 73118535 missense probably damaging 0.98
IGL02378:Itgae APN 11 73118121 missense probably benign 0.00
IGL02525:Itgae APN 11 73130951 missense probably damaging 0.98
IGL02576:Itgae APN 11 73118505 missense possibly damaging 0.95
IGL02729:Itgae APN 11 73118203 splice site probably benign
IGL02859:Itgae APN 11 73114867 missense probably damaging 1.00
IGL03074:Itgae APN 11 73125310 missense probably benign 0.00
IGL03107:Itgae APN 11 73113601 missense probably damaging 1.00
IGL03264:Itgae APN 11 73115574 missense possibly damaging 0.73
IGL03272:Itgae APN 11 73133854 unclassified probably null
IGL03352:Itgae APN 11 73131730 missense probably damaging 1.00
R0134:Itgae UTSW 11 73111342 missense probably benign 0.00
R0225:Itgae UTSW 11 73111342 missense probably benign 0.00
R0320:Itgae UTSW 11 73130999 missense possibly damaging 0.74
R0403:Itgae UTSW 11 73123183 missense possibly damaging 0.89
R0631:Itgae UTSW 11 73114907 missense probably damaging 1.00
R0833:Itgae UTSW 11 73129206 missense probably benign 0.02
R0836:Itgae UTSW 11 73129206 missense probably benign 0.02
R0973:Itgae UTSW 11 73138509 nonsense probably null
R1231:Itgae UTSW 11 73119379 missense probably benign 0.02
R1389:Itgae UTSW 11 73125362 missense probably damaging 1.00
R1433:Itgae UTSW 11 73115592 missense probably damaging 1.00
R1534:Itgae UTSW 11 73145605 missense possibly damaging 0.58
R1833:Itgae UTSW 11 73117162 missense possibly damaging 0.94
R1914:Itgae UTSW 11 73118643 splice site probably benign
R1915:Itgae UTSW 11 73118643 splice site probably benign
R2061:Itgae UTSW 11 73118622 missense probably benign 0.00
R2380:Itgae UTSW 11 73145569 missense probably benign 0.00
R2435:Itgae UTSW 11 73121937 nonsense probably null
R2680:Itgae UTSW 11 73114926 missense probably damaging 1.00
R2886:Itgae UTSW 11 73140687 missense probably benign 0.04
R3873:Itgae UTSW 11 73113616 missense probably damaging 1.00
R3923:Itgae UTSW 11 73116143 missense probably damaging 0.99
R4010:Itgae UTSW 11 73111339 missense probably benign 0.00
R4059:Itgae UTSW 11 73112134 missense probably benign
R4212:Itgae UTSW 11 73119352 missense probably benign
R4213:Itgae UTSW 11 73119352 missense probably benign
R4691:Itgae UTSW 11 73119519 nonsense probably null
R4736:Itgae UTSW 11 73114880 missense possibly damaging 0.79
R5152:Itgae UTSW 11 73130995 missense probably damaging 1.00
R5201:Itgae UTSW 11 73110556 missense probably benign 0.00
R5307:Itgae UTSW 11 73145638 missense probably benign 0.00
R5362:Itgae UTSW 11 73111849 missense probably damaging 1.00
R5448:Itgae UTSW 11 73133908 critical splice donor site probably null
R5645:Itgae UTSW 11 73129248 missense probably damaging 1.00
R5672:Itgae UTSW 11 73145551 missense possibly damaging 0.96
R6079:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6138:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6226:Itgae UTSW 11 73140757 missense probably benign 0.11
R6244:Itgae UTSW 11 73145601 missense probably damaging 0.96
R6326:Itgae UTSW 11 73131693 missense possibly damaging 0.88
R6332:Itgae UTSW 11 73111402 splice site probably null
R6502:Itgae UTSW 11 73145592 missense probably benign 0.10
R6825:Itgae UTSW 11 73118496 missense possibly damaging 0.89
R7016:Itgae UTSW 11 73119516 missense probably damaging 0.99
R7020:Itgae UTSW 11 73111369 missense probably damaging 1.00
R7069:Itgae UTSW 11 73116143 missense probably damaging 0.99
R7132:Itgae UTSW 11 73111358 missense possibly damaging 0.93
U15987:Itgae UTSW 11 73115574 missense possibly damaging 0.73
X0024:Itgae UTSW 11 73111376 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATGCCACTGTCAGTGCAGAAC -3'
(R):5'- ATGGAGCAGCCACCAGTAGAAAATC -3'

Sequencing Primer
(F):5'- CAGTGCAGAACTGACTTTAGTG -3'
(R):5'- GTAGAAAATCTGTGGTCCCATCC -3'
Posted On2013-04-16