Incidental Mutation 'R3153:Kank1'
ID264505
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene NameKN motif and ankyrin repeat domains 1
SynonymsD330024H06Rik, Ankrd15, A930031B09Rik
MMRRC Submission 040604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3153 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location25236975-25434496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25410688 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 575 (V575E)
Ref Sequence ENSEMBL: ENSMUSP00000116660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
Predicted Effect probably benign
Transcript: ENSMUST00000049400
AA Change: V547E

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: V547E

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137260
Predicted Effect possibly damaging
Transcript: ENSMUST00000146647
AA Change: V575E

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: V575E

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Abhd12 A G 2: 150,834,355 F361L probably benign Het
Abr A T 11: 76,486,469 I59N probably damaging Het
Agbl1 A G 7: 76,720,196 E681G probably damaging Het
B3gnt4 G T 5: 123,510,653 R27L probably benign Het
Cct8l1 A C 5: 25,517,139 E284A probably damaging Het
Chd7 T A 4: 8,855,174 N2134K probably benign Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cndp2 C A 18: 84,668,597 M433I probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Col20a1 C T 2: 181,008,593 P1074L probably damaging Het
Coq6 G A 12: 84,371,535 V298M probably damaging Het
Cpt1a A G 19: 3,356,430 Y132C probably damaging Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Eps8l1 A T 7: 4,471,799 I321F probably damaging Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fcrl5 T C 3: 87,443,680 F166L probably benign Het
Gatc T C 5: 115,335,487 E131G probably benign Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gprc5b G A 7: 118,976,547 P385L probably damaging Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Hsd3b1 T C 3: 98,852,664 D337G probably damaging Het
Ireb2 T C 9: 54,885,946 probably null Het
Kcnmb1 A T 11: 33,966,339 D95V probably damaging Het
L3mbtl4 T A 17: 68,457,248 Y125* probably null Het
Lce1h C T 3: 92,763,675 G57R unknown Het
Lgalsl A G 11: 20,826,487 F135S probably damaging Het
Lrba A G 3: 86,285,219 M147V probably damaging Het
Mdm2 T C 10: 117,709,713 E23G possibly damaging Het
Mthfd1 C A 12: 76,311,963 Q67K probably benign Het
Mtus2 T C 5: 148,083,060 L755P probably damaging Het
Olfr1026 T C 2: 85,923,730 V154A probably benign Het
Orc3 A G 4: 34,575,124 F587L probably damaging Het
Pcdhb7 C T 18: 37,343,073 P421S probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Pkd1l1 A C 11: 8,867,207 S1364A probably benign Het
Rin3 A C 12: 102,368,541 E157A unknown Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Rph3a T C 5: 120,973,377 T47A probably damaging Het
Sap18 T C 14: 57,801,945 M68T probably benign Het
Sfrp2 A G 3: 83,773,270 T246A probably benign Het
Slc18a3 A G 14: 32,463,271 V385A probably benign Het
Slitrk3 C T 3: 73,048,982 W819* probably null Het
Smap1 A T 1: 23,853,549 D111E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Sv2a T A 3: 96,185,258 D91E possibly damaging Het
Tbc1d5 A G 17: 50,968,236 I77T probably damaging Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Zbtb38 T C 9: 96,688,249 K261E probably benign Het
Zfp202 T C 9: 40,208,438 L179P probably benign Het
Zkscan5 T A 5: 145,212,627 S251R probably benign Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25411758 missense probably benign
IGL00435:Kank1 APN 19 25430236 missense probably benign 0.41
IGL01105:Kank1 APN 19 25424316 missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25410232 missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25410702 missense probably benign 0.01
IGL02125:Kank1 APN 19 25410703 missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25428172 missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25430338 missense probably damaging 1.00
IGL02440:Kank1 APN 19 25432908 missense probably damaging 1.00
IGL02448:Kank1 APN 19 25411375 missense probably damaging 1.00
IGL02671:Kank1 APN 19 25428095 missense probably damaging 1.00
IGL03102:Kank1 APN 19 25425918 missense probably damaging 1.00
IGL03259:Kank1 APN 19 25430341 missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25411599 missense probably damaging 1.00
R0107:Kank1 UTSW 19 25430366 unclassified probably benign
R0190:Kank1 UTSW 19 25409283 missense probably benign 0.00
R0330:Kank1 UTSW 19 25424313 missense probably benign 0.00
R0368:Kank1 UTSW 19 25410603 nonsense probably null
R0399:Kank1 UTSW 19 25411242 missense probably benign 0.00
R0426:Kank1 UTSW 19 25411473 missense probably damaging 1.00
R0483:Kank1 UTSW 19 25425993 unclassified probably benign
R1394:Kank1 UTSW 19 25428164 missense probably damaging 1.00
R1495:Kank1 UTSW 19 25410349 missense probably damaging 0.98
R1681:Kank1 UTSW 19 25410304 missense possibly damaging 0.89
R1698:Kank1 UTSW 19 25411317 missense probably benign 0.11
R1830:Kank1 UTSW 19 25411032 missense probably benign 0.00
R1866:Kank1 UTSW 19 25411449 missense probably benign 0.04
R2138:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2139:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2420:Kank1 UTSW 19 25410457 missense probably damaging 1.00
R4164:Kank1 UTSW 19 25411072 missense probably benign 0.10
R4670:Kank1 UTSW 19 25410580 missense probably benign 0.00
R4685:Kank1 UTSW 19 25410034 missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25431007 missense probably damaging 1.00
R4981:Kank1 UTSW 19 25411395 missense probably benign 0.19
R5189:Kank1 UTSW 19 25424181 missense probably damaging 1.00
R5280:Kank1 UTSW 19 25411305 missense probably benign 0.01
R5330:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5331:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5435:Kank1 UTSW 19 25411143 missense probably benign 0.04
R5500:Kank1 UTSW 19 25424332 missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25424200 missense probably damaging 1.00
R6087:Kank1 UTSW 19 25409724 missense probably benign 0.41
R6357:Kank1 UTSW 19 25411353 missense probably benign 0.36
R6490:Kank1 UTSW 19 25410085 missense probably damaging 1.00
R6504:Kank1 UTSW 19 25428154 missense probably damaging 1.00
R6942:Kank1 UTSW 19 25424173 missense possibly damaging 0.88
R7037:Kank1 UTSW 19 25430341 missense probably damaging 1.00
R7405:Kank1 UTSW 19 25410319 nonsense probably null
R7486:Kank1 UTSW 19 25410829 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGCGAGATGACTAAGCTCAAG -3'
(R):5'- TAAGGAGTGTCAGGTCGCTC -3'

Sequencing Primer
(F):5'- GCAAGAACTACAGGCTGCCG -3'
(R):5'- CCAGAAGCCTCTGTGTTGCTG -3'
Posted On2015-02-05