Mutagenetix > Incidental Mutation

Incidental Mutation 'R2931:Strip1'

264531

Institutional Source

Beutler Lab

Gene Symbol

Strip1

Ensembl Gene

ENSMUSG00000014601

Gene Name

striatin interacting protein 1

Synonyms

Fam40a, 6330569M22Rik, 6530401O14Rik

MMRRC Submission

040513-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R2931 (G1)

Quality Score

131

Status

Not validated

Chromosome

Chromosomal Location

107519848-107539010 bp(-) (GRCm39)

Type of Mutation

splice site (22 bp from exon)

DNA Base Change (assembly)

T to A at 107532975 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000068587 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064759]

AlphaFold

Q8C079

Predicted Effect

probably null
Transcript: ENSMUST00000064759

SMART Domains

Protein: ENSMUSP00000068587
Gene: ENSMUSG00000014601

Domain	Start	End	E-Value	Type
low complexity region	17	46	N/A	INTRINSIC
N1221	65	363	7.87e-138	SMART
low complexity region	376	394	N/A	INTRINSIC
DUF3402	460	817	6.87e-202	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196416

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198424

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the striatin-interacting phosphatase and kinase complex, which is involved in localization of the Golgi body. The encoded protein participates in cytosketelal organization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, shortened anterior-posterior axis, cinching of tissue at the embryonic/extraembryonic boundary and abnormal mesoderm development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	C	T	10: 10,318,246 (GRCm39)	V193I	possibly damaging	Het
Asb2	T	C	12: 103,301,146 (GRCm39)	D151G	probably damaging	Het
Cyp2c69	G	A	19: 39,837,927 (GRCm39)	T385I	probably damaging	Het
Dhx15	G	A	5: 52,324,074 (GRCm39)	P406L	probably benign	Het
Dido1	T	C	2: 180,303,446 (GRCm39)	E1486G	probably damaging	Het
Kdm5d	T	C	Y: 942,992 (GRCm39)	F1492L	probably benign	Het
Map2k4	A	T	11: 65,647,163 (GRCm39)	N59K	probably damaging	Het
Myo18b	A	G	5: 112,840,993 (GRCm39)	S2267P	probably benign	Het
Naip2	A	T	13: 100,291,529 (GRCm39)	D1136E	probably benign	Het
Otogl	A	T	10: 107,655,865 (GRCm39)	M1080K	possibly damaging	Het
Pirb	A	T	7: 3,720,205 (GRCm39)	H389Q	probably benign	Het
Sptan1	A	G	2: 29,908,500 (GRCm39)	T1739A	probably benign	Het
Trappc11	A	T	8: 47,956,977 (GRCm39)	D816E	probably damaging	Het
Zscan12	A	G	13: 21,548,187 (GRCm39)	D123G	possibly damaging	Het

Other mutations in Strip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Strip1	APN	3	107,528,761 (GRCm39)	missense	probably damaging	0.99
IGL01150:Strip1	APN	3	107,534,047 (GRCm39)	splice site	probably null
IGL01484:Strip1	APN	3	107,520,575 (GRCm39)	missense	probably damaging	0.99
IGL01862:Strip1	APN	3	107,529,198 (GRCm39)	missense	probably damaging	0.99
IGL02425:Strip1	APN	3	107,521,962 (GRCm39)	missense	probably benign	0.08
IGL02537:Strip1	APN	3	107,524,210 (GRCm39)	missense	possibly damaging	0.94
IGL02948:Strip1	APN	3	107,520,582 (GRCm39)	missense	probably benign	0.33
IGL03179:Strip1	APN	3	107,527,571 (GRCm39)	missense	probably damaging	0.99
PIT4472001:Strip1	UTSW	3	107,535,486 (GRCm39)	missense	probably benign	0.19
R0197:Strip1	UTSW	3	107,521,929 (GRCm39)	missense	probably damaging	0.99
R0526:Strip1	UTSW	3	107,527,355 (GRCm39)	critical splice donor site	probably null
R0543:Strip1	UTSW	3	107,534,091 (GRCm39)	missense	possibly damaging	0.93
R0883:Strip1	UTSW	3	107,521,929 (GRCm39)	missense	probably damaging	0.99
R1070:Strip1	UTSW	3	107,534,724 (GRCm39)	missense	possibly damaging	0.81
R1384:Strip1	UTSW	3	107,534,155 (GRCm39)	missense	probably benign	0.00
R1467:Strip1	UTSW	3	107,534,724 (GRCm39)	missense	possibly damaging	0.81
R1467:Strip1	UTSW	3	107,534,724 (GRCm39)	missense	possibly damaging	0.81
R1772:Strip1	UTSW	3	107,534,047 (GRCm39)	splice site	probably null
R2358:Strip1	UTSW	3	107,523,135 (GRCm39)	missense	probably benign	0.01
R2484:Strip1	UTSW	3	107,535,537 (GRCm39)	missense	possibly damaging	0.81
R3427:Strip1	UTSW	3	107,524,138 (GRCm39)	missense	possibly damaging	0.68
R4584:Strip1	UTSW	3	107,531,819 (GRCm39)	missense	probably benign	0.39
R4780:Strip1	UTSW	3	107,534,314 (GRCm39)	missense	probably benign	0.01
R4853:Strip1	UTSW	3	107,524,232 (GRCm39)	missense	possibly damaging	0.93
R5623:Strip1	UTSW	3	107,534,142 (GRCm39)	missense	possibly damaging	0.69
R5801:Strip1	UTSW	3	107,528,757 (GRCm39)	missense	possibly damaging	0.50
R6345:Strip1	UTSW	3	107,535,516 (GRCm39)	missense	probably damaging	1.00
R6860:Strip1	UTSW	3	107,526,252 (GRCm39)	missense	possibly damaging	0.50
R6869:Strip1	UTSW	3	107,520,761 (GRCm39)	missense	probably damaging	1.00
R7022:Strip1	UTSW	3	107,534,111 (GRCm39)	missense	probably benign	0.09
R7192:Strip1	UTSW	3	107,522,651 (GRCm39)	missense	possibly damaging	0.94
R7387:Strip1	UTSW	3	107,533,046 (GRCm39)	missense	probably damaging	0.99
R7631:Strip1	UTSW	3	107,524,247 (GRCm39)	missense	possibly damaging	0.46
R8032:Strip1	UTSW	3	107,525,394 (GRCm39)	missense	probably damaging	0.99
R8095:Strip1	UTSW	3	107,525,455 (GRCm39)	missense	possibly damaging	0.82
R8302:Strip1	UTSW	3	107,533,024 (GRCm39)	missense	probably damaging	1.00
R8725:Strip1	UTSW	3	107,521,964 (GRCm39)	missense	probably damaging	1.00
R8727:Strip1	UTSW	3	107,521,964 (GRCm39)	missense	probably damaging	1.00
R8882:Strip1	UTSW	3	107,534,341 (GRCm39)	missense	probably benign	0.17
R9184:Strip1	UTSW	3	107,521,979 (GRCm39)	missense	probably benign	0.28
R9185:Strip1	UTSW	3	107,535,530 (GRCm39)	missense	probably damaging	0.99
Z1177:Strip1	UTSW	3	107,523,085 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCAGATCTATTAAGAGGCTCGATCC -3'
(R):5'- AGTGGTGTCCTAAGGTCTCG -3'

Sequencing Primer
(F):5'- TAAGAGGCTCGATCCCAGATTTC -3'
(R):5'- TCTCGTGTAGAGCCCAGATG -3'

Posted On

2015-02-05