Incidental Mutation 'R0344:Atp5s'
ID26455
Institutional Source Beutler Lab
Gene Symbol Atp5s
Ensembl Gene ENSMUSG00000054894
Gene NameATP synthase, H+ transporting, mitochondrial F0 complex, subunit S
Synonyms1110015E18Rik, facyor B
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69724950-69744660 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 69740889 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021372] [ENSMUST00000220460] [ENSMUST00000220539] [ENSMUST00000220916] [ENSMUST00000222950]
Predicted Effect probably benign
Transcript: ENSMUST00000021372
SMART Domains Protein: ENSMUSP00000021372
Gene: ENSMUSG00000054894

DomainStartEndE-ValueType
PDB:3E4G|A 26 200 1e-102 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000220460
Predicted Effect probably benign
Transcript: ENSMUST00000220539
Predicted Effect probably benign
Transcript: ENSMUST00000220916
Predicted Effect probably benign
Transcript: ENSMUST00000222950
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. This gene encodes the subunit s, also known as factor B, of the proton channel. This subunit is necessary for the energy transduction activity of the ATP synthase complexes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Atp5s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02513:Atp5s APN 12 69741045 missense probably benign 0.00
R0848:Atp5s UTSW 12 69741810 missense probably benign 0.30
R1236:Atp5s UTSW 12 69741818 critical splice donor site probably null
R1539:Atp5s UTSW 12 69741071 missense probably benign 0.04
R2143:Atp5s UTSW 12 69741054 missense probably damaging 0.97
R2144:Atp5s UTSW 12 69741054 missense probably damaging 0.97
R2145:Atp5s UTSW 12 69741054 missense probably damaging 0.97
R5957:Atp5s UTSW 12 69743784 missense probably benign
R7157:Atp5s UTSW 12 69741788 missense probably benign 0.06
R7257:Atp5s UTSW 12 69741669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGACCCTGCCTCCAAAACCTTAG -3'
(R):5'- CCCATGTGATCCAAGCCAATGTCC -3'

Sequencing Primer
(F):5'- aagaaaggaaaaagtgaacagaaaag -3'
(R):5'- AATCGGTGGCATCAATTGC -3'
Posted On2013-04-16