Incidental Mutation 'R0344:Srsf5'
ID26457
Institutional Source Beutler Lab
Gene Symbol Srsf5
Ensembl Gene ENSMUSG00000021134
Gene Nameserine/arginine-rich splicing factor 5
SynonymsSfrs5
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80945504-80950507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80947524 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 76 (S76P)
Ref Sequence ENSEMBL: ENSMUSP00000105985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094693] [ENSMUST00000110351] [ENSMUST00000110352] [ENSMUST00000110354] [ENSMUST00000110356] [ENSMUST00000138434]
Predicted Effect probably benign
Transcript: ENSMUST00000094693
AA Change: S76P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131323
Gene: ENSMUSG00000021134
AA Change: S76P

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110351
AA Change: S76P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105980
Gene: ENSMUSG00000021134
AA Change: S76P

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110352
AA Change: S76P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105981
Gene: ENSMUSG00000021134
AA Change: S76P

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110354
AA Change: S76P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105983
Gene: ENSMUSG00000021134
AA Change: S76P

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110356
AA Change: S76P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105985
Gene: ENSMUSG00000021134
AA Change: S76P

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133783
Predicted Effect probably benign
Transcript: ENSMUST00000138434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219062
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Srsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Srsf5 APN 12 80947834 missense probably damaging 1.00
R0827:Srsf5 UTSW 12 80949540 missense probably damaging 1.00
R1552:Srsf5 UTSW 12 80949745 unclassified probably benign
R2519:Srsf5 UTSW 12 80949096 missense probably damaging 0.99
R4926:Srsf5 UTSW 12 80947301 utr 3 prime probably benign
R5505:Srsf5 UTSW 12 80949083 unclassified probably benign
R5786:Srsf5 UTSW 12 80949537 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CACGTCCAAAAGCTCTACTCTTACTGC -3'
(R):5'- CTGGGTTCTCAGCATGTGGACTAAC -3'

Sequencing Primer
(F):5'- GCTACATTTTAGGAATTTGAGGACCC -3'
(R):5'- TCTCAGCATGTGGACTAACTAGAC -3'
Posted On2013-04-16