Incidental Mutation 'R0344:Ahrr'
ID26459
Institutional Source Beutler Lab
Gene Symbol Ahrr
Ensembl Gene ENSMUSG00000021575
Gene Namearyl-hydrocarbon receptor repressor
Synonyms
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location74211118-74292331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74214586 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 393 (S393C)
Ref Sequence ENSEMBL: ENSMUSP00000022059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022059] [ENSMUST00000109640]
Predicted Effect probably damaging
Transcript: ENSMUST00000022059
AA Change: S393C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022059
Gene: ENSMUSG00000021575
AA Change: S393C

DomainStartEndE-ValueType
HLH 32 86 1.1e-11 SMART
PAS 108 174 6.6e-14 SMART
low complexity region 236 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109640
AA Change: S265C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105268
Gene: ENSMUSG00000021575
AA Change: S265C

DomainStartEndE-ValueType
Blast:PAS 1 46 1e-27 BLAST
PDB:4M4X|B 1 142 2e-30 PDB
SCOP:d1jnua_ 2 63 7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148438
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: This gene encodes a protein that represses aryl hydrocarbon receptor-dependent signaling. The encoded protein competes with the aryl hydrocarbon receptor transcription factor for heterodimerization with the aryl hydrocarbon receptor nuclear translocator protein and binding to xenobiotic response element (XRE) sequence in many genes. This protein is implicated in the regulation of cell growth and differentiation as well as mediating dioxin toxicity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Ahrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Ahrr APN 13 74220573 missense possibly damaging 0.52
IGL03143:Ahrr APN 13 74257495 nonsense probably null
calico_jack UTSW 13 74222912 missense possibly damaging 0.51
R0009:Ahrr UTSW 13 74283024 splice site probably benign
R0010:Ahrr UTSW 13 74283024 splice site probably benign
R0010:Ahrr UTSW 13 74283024 splice site probably benign
R0040:Ahrr UTSW 13 74283024 splice site probably benign
R0079:Ahrr UTSW 13 74283024 splice site probably benign
R0082:Ahrr UTSW 13 74283024 splice site probably benign
R0164:Ahrr UTSW 13 74283024 splice site probably benign
R0165:Ahrr UTSW 13 74283024 splice site probably benign
R0167:Ahrr UTSW 13 74283024 splice site probably benign
R0310:Ahrr UTSW 13 74283024 splice site probably benign
R0948:Ahrr UTSW 13 74213769 missense probably damaging 1.00
R1192:Ahrr UTSW 13 74214403 missense probably benign 0.00
R1438:Ahrr UTSW 13 74224868 nonsense probably null
R1532:Ahrr UTSW 13 74213707 missense probably benign 0.01
R1600:Ahrr UTSW 13 74214378 missense probably benign 0.00
R2302:Ahrr UTSW 13 74277661 missense probably damaging 1.00
R3055:Ahrr UTSW 13 74224887 missense probably damaging 1.00
R4683:Ahrr UTSW 13 74224766 splice site silent
R4717:Ahrr UTSW 13 74215766 missense probably benign 0.03
R4769:Ahrr UTSW 13 74214212 missense probably damaging 1.00
R5998:Ahrr UTSW 13 74213836 missense probably damaging 0.99
R6225:Ahrr UTSW 13 74222912 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CGACAAGGGTCTGTTCATCTGACTG -3'
(R):5'- GGTCTGGGAAGATTTGAAGCTGCC -3'

Sequencing Primer
(F):5'- CTCTAAAAGAAGCCATGTTGCTGG -3'
(R):5'- GGTATCATACTAAGTTGCCATCCAC -3'
Posted On2013-04-16