Incidental Mutation 'R2939:Slc1a6'
ID264595
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
SynonymsEAAT4
MMRRC Submission 040516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R2939 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78780496-78814765 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) G to T at 78814614 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Leucine at position 562 (*562L)
Ref Sequence ENSEMBL: ENSMUSP00000005490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490]
Predicted Effect probably null
Transcript: ENSMUST00000005490
AA Change: *562L
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: *562L

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Meta Mutation Damage Score 0.506 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,946 K760E probably benign Het
1810043G02Rik A G 10: 77,981,673 N78S probably benign Het
Actl11 T C 9: 107,931,210 Y911H possibly damaging Het
Arhgef26 A C 3: 62,380,910 K467T possibly damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Atm T C 9: 53,494,711 Y1219C probably damaging Het
Azin2 C T 4: 128,934,604 C270Y probably benign Het
Brsk1 A T 7: 4,708,140 I545F possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cfap69 G A 5: 5,644,432 A143V probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Col5a3 T C 9: 20,795,658 K714R unknown Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dagla A C 19: 10,256,364 F382C probably damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif5 T C 12: 111,540,279 C102R probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam71a T C 1: 191,163,906 D180G possibly damaging Het
Fhdc1 A G 3: 84,457,270 V223A possibly damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Gpatch8 A G 11: 102,508,184 V74A unknown Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Ksr1 A G 11: 79,045,181 probably null Het
Lama5 A C 2: 180,198,954 Y584D probably damaging Het
Lgi4 C T 7: 31,067,828 R427* probably null Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nmnat2 C A 1: 153,074,728 S53Y probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcsk7 C T 9: 45,916,024 A363V probably damaging Het
Pdrg1 C T 2: 153,012,435 G62R probably damaging Het
Pdzd7 A G 19: 45,045,423 I74T possibly damaging Het
Plcb4 T C 2: 135,939,203 probably benign Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Rph3a A G 5: 120,980,149 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Slc45a3 A G 1: 131,977,899 E206G probably damaging Het
Slc9a3r1 C T 11: 115,180,444 R335C probably damaging Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Smpd3 A G 8: 106,257,407 V560A probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Suco A G 1: 161,848,651 I386T probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmprss11e G A 5: 86,721,407 R96W probably damaging Het
Trim63 T C 4: 134,322,997 probably benign Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Unc79 C T 12: 102,991,425 T33I probably damaging Het
Usp47 G A 7: 112,082,536 S518N probably damaging Het
Vmn2r22 T A 6: 123,637,635 D332V probably damaging Het
Vmn2r55 A G 7: 12,651,905 L716P probably damaging Het
Zfp558 T C 9: 18,456,628 N288S possibly damaging Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78801813 missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78793308 missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78788997 missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78793303 missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78789064 missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78801954 missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78814608 missense probably benign
IGL03185:Slc1a6 APN 10 78801907 missense probably damaging 1.00
IGL03046:Slc1a6 UTSW 10 78800174 missense probably benign 0.19
R0183:Slc1a6 UTSW 10 78791233 missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78801922 nonsense probably null
R0730:Slc1a6 UTSW 10 78796008 missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78812824 missense probably benign 0.03
R0838:Slc1a6 UTSW 10 78796222 missense probably damaging 1.00
R1449:Slc1a6 UTSW 10 78800117 missense probably damaging 0.99
R1822:Slc1a6 UTSW 10 78812931 nonsense probably null
R1853:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78791349 missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78800130 missense possibly damaging 0.93
R2279:Slc1a6 UTSW 10 78789048 missense probably benign 0.12
R2360:Slc1a6 UTSW 10 78812884 missense possibly damaging 0.91
R3111:Slc1a6 UTSW 10 78789081 missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78812881 missense possibly damaging 0.91
R4116:Slc1a6 UTSW 10 78787889 missense probably benign 0.00
R4798:Slc1a6 UTSW 10 78800118 missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78796251 missense probably damaging 1.00
R5054:Slc1a6 UTSW 10 78814602 missense probably damaging 1.00
R5166:Slc1a6 UTSW 10 78796269 critical splice donor site probably null
R5304:Slc1a6 UTSW 10 78793307 missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78787803 missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78795982 missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78789091 missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78793277 splice site probably null
R6117:Slc1a6 UTSW 10 78788988 missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78801837 missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78801907 missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78800076 missense probably damaging 0.98
R6323:Slc1a6 UTSW 10 78812887 missense probably damaging 1.00
R6339:Slc1a6 UTSW 10 78800085 missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78787812 missense probably benign 0.00
R7166:Slc1a6 UTSW 10 78812812 missense possibly damaging 0.96
R7292:Slc1a6 UTSW 10 78814604 missense possibly damaging 0.84
R7548:Slc1a6 UTSW 10 78814431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCTTCCACCAGTGACCGAC -3'
(R):5'- GGTTGTTCTTATATTTCGAGCACAC -3'

Sequencing Primer
(F):5'- AGTGACCGACTTCGTACAATG -3'
(R):5'- CTTATATTTCGAGCACACAAATGC -3'
Posted On2015-02-05