Incidental Mutation 'R2939:Ksr1'
ID264598
Institutional Source Beutler Lab
Gene Symbol Ksr1
Ensembl Gene ENSMUSG00000018334
Gene Namekinase suppressor of ras 1
SynonymsD11Bhm183e, B-KSR1, D11Bhm184e
MMRRC Submission 040516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R2939 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79013440-79146407 bp(-) (GRCm38)
Type of Mutationunclassified (2 bp from exon)
DNA Base Change (assembly) A to G at 79045181 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018478] [ENSMUST00000108264] [ENSMUST00000129463] [ENSMUST00000141409] [ENSMUST00000208969] [ENSMUST00000226282]
Predicted Effect probably benign
Transcript: ENSMUST00000018478
AA Change: L201P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000018478
Gene: ENSMUSG00000018334
AA Change: L201P

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 2.7e-41 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase_Tyr 563 827 2.3e-48 PFAM
Pfam:Pkinase 563 828 1.5e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108264
AA Change: L201P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103899
Gene: ENSMUSG00000018334
AA Change: L201P

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 8.9e-51 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase 563 637 1e-6 PFAM
Pfam:Pkinase_Tyr 563 637 2e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129463
SMART Domains Protein: ENSMUSP00000114538
Gene: ENSMUSG00000018334

DomainStartEndE-ValueType
Pfam:KSR1-SAM 1 46 5.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141409
AA Change: L119P

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116407
Gene: ENSMUSG00000018334
AA Change: L119P

DomainStartEndE-ValueType
Pfam:KSR1-SAM 35 84 1.6e-12 PFAM
low complexity region 189 196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208969
AA Change: L126P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226282
AA Change: L119P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.622 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit disorganized hair follicles and a decreased susceptibility to papilloma formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,946 K760E probably benign Het
1810043G02Rik A G 10: 77,981,673 N78S probably benign Het
Actl11 T C 9: 107,931,210 Y911H possibly damaging Het
Arhgef26 A C 3: 62,380,910 K467T possibly damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Atm T C 9: 53,494,711 Y1219C probably damaging Het
Azin2 C T 4: 128,934,604 C270Y probably benign Het
Brsk1 A T 7: 4,708,140 I545F possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cfap69 G A 5: 5,644,432 A143V probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Col5a3 T C 9: 20,795,658 K714R unknown Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dagla A C 19: 10,256,364 F382C probably damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif5 T C 12: 111,540,279 C102R probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam71a T C 1: 191,163,906 D180G possibly damaging Het
Fhdc1 A G 3: 84,457,270 V223A possibly damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Gpatch8 A G 11: 102,508,184 V74A unknown Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Lama5 A C 2: 180,198,954 Y584D probably damaging Het
Lgi4 C T 7: 31,067,828 R427* probably null Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nmnat2 C A 1: 153,074,728 S53Y probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcsk7 C T 9: 45,916,024 A363V probably damaging Het
Pdrg1 C T 2: 153,012,435 G62R probably damaging Het
Pdzd7 A G 19: 45,045,423 I74T possibly damaging Het
Plcb4 T C 2: 135,939,203 probably benign Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Rph3a A G 5: 120,980,149 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc1a6 G T 10: 78,814,614 *562L probably null Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Slc45a3 A G 1: 131,977,899 E206G probably damaging Het
Slc9a3r1 C T 11: 115,180,444 R335C probably damaging Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Smpd3 A G 8: 106,257,407 V560A probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Suco A G 1: 161,848,651 I386T probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmprss11e G A 5: 86,721,407 R96W probably damaging Het
Trim63 T C 4: 134,322,997 probably benign Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Unc79 C T 12: 102,991,425 T33I probably damaging Het
Usp47 G A 7: 112,082,536 S518N probably damaging Het
Vmn2r22 T A 6: 123,637,635 D332V probably damaging Het
Vmn2r55 A G 7: 12,651,905 L716P probably damaging Het
Zfp558 T C 9: 18,456,628 N288S possibly damaging Het
Other mutations in Ksr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ksr1 APN 11 79027517 missense probably damaging 1.00
IGL01304:Ksr1 APN 11 79027642 missense probably damaging 1.00
IGL01482:Ksr1 APN 11 79036583 missense probably damaging 1.00
IGL01928:Ksr1 APN 11 79044839 splice site probably null
IGL02025:Ksr1 APN 11 79021450 unclassified probably null
IGL02176:Ksr1 APN 11 79020791 missense probably benign 0.00
IGL02374:Ksr1 APN 11 79028491 missense probably benign 0.02
IGL02511:Ksr1 APN 11 79045220 missense possibly damaging 0.55
IGL02563:Ksr1 APN 11 79044858 missense possibly damaging 0.73
IGL02662:Ksr1 APN 11 79036725 missense probably damaging 1.00
IGL02823:Ksr1 APN 11 79021403 missense probably benign 0.35
IGL02879:Ksr1 APN 11 79074444 missense probably damaging 1.00
julius UTSW 11 79036494 critical splice donor site probably null
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0364:Ksr1 UTSW 11 79029025 splice site probably benign
R0479:Ksr1 UTSW 11 79025283 missense probably damaging 1.00
R0590:Ksr1 UTSW 11 79045140 missense probably damaging 1.00
R0711:Ksr1 UTSW 11 79038247 splice site probably benign
R0743:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R0884:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R1272:Ksr1 UTSW 11 79146078 nonsense probably null
R1739:Ksr1 UTSW 11 79047305 missense probably damaging 1.00
R1885:Ksr1 UTSW 11 79020378 missense probably null
R1885:Ksr1 UTSW 11 79036521 missense probably damaging 1.00
R1886:Ksr1 UTSW 11 79020378 missense probably null
R2118:Ksr1 UTSW 11 79045193 missense probably benign 0.10
R2127:Ksr1 UTSW 11 79033313 missense probably damaging 1.00
R4090:Ksr1 UTSW 11 79027477 missense probably damaging 1.00
R4675:Ksr1 UTSW 11 79074360 missense possibly damaging 0.81
R4854:Ksr1 UTSW 11 79027702 missense probably damaging 1.00
R5267:Ksr1 UTSW 11 79020425 missense probably damaging 1.00
R5813:Ksr1 UTSW 11 79038198 missense probably damaging 1.00
R5928:Ksr1 UTSW 11 79059719 missense probably damaging 0.96
R6199:Ksr1 UTSW 11 79020441 missense possibly damaging 0.65
R6346:Ksr1 UTSW 11 79019664 missense possibly damaging 0.93
R6377:Ksr1 UTSW 11 79036494 critical splice donor site probably null
R6885:Ksr1 UTSW 11 79047295 critical splice donor site probably null
R7016:Ksr1 UTSW 11 79027536 missense probably damaging 1.00
U24488:Ksr1 UTSW 11 79047441 missense probably damaging 1.00
Z1088:Ksr1 UTSW 11 79044879 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TCGATTCGGTTTCCCAGCTG -3'
(R):5'- AATGGTGTTACCTCCGTCAC -3'

Sequencing Primer
(F):5'- AGCAGCTGGAAGACCTTGC -3'
(R):5'- CGGTGTCATGCTCTCCCATAGTAG -3'
Posted On2015-02-05