Incidental Mutation 'R2966:Rasal1'
ID264648
Institutional Source Beutler Lab
Gene Symbol Rasal1
Ensembl Gene ENSMUSG00000029602
Gene NameRAS protein activator like 1 (GAP1 like)
SynonymsMRASAL
MMRRC Submission 040522-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2966 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120648812-120679597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120671620 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 530 (L530Q)
Ref Sequence ENSEMBL: ENSMUSP00000123266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000156722]
Predicted Effect probably damaging
Transcript: ENSMUST00000031606
AA Change: L530Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602
AA Change: L530Q

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156722
AA Change: L530Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602
AA Change: L530Q

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
9230110C19Rik C T 9: 8,027,174 R121Q probably damaging Het
Adamts1 A G 16: 85,796,774 V691A possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp11a A T 8: 12,847,853 probably null Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Bnc2 G A 4: 84,293,517 A300V probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gabra5 T C 7: 57,408,641 E453G probably damaging Het
Gatd1 T A 7: 141,409,167 D193V probably damaging Het
Gm6871 T G 7: 41,573,440 T75P probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Has2 A G 15: 56,682,137 L23P probably damaging Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Myh1 A G 11: 67,214,584 K1067E probably damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Nsd2 G C 5: 33,846,122 E205D probably benign Het
Pclo T C 5: 14,681,150 L3222P unknown Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rbm15b A G 9: 106,885,592 L459P probably damaging Het
Recql A G 6: 142,363,587 V586A probably benign Het
Rprd2 A T 3: 95,766,433 probably null Het
Sis T A 3: 72,889,010 I1813L probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sympk T C 7: 19,030,544 V58A probably damaging Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r39 A C 6: 66,804,731 I201S possibly damaging Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Rasal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Rasal1 APN 5 120664807 missense probably damaging 1.00
IGL01700:Rasal1 APN 5 120676817 missense probably benign 0.06
IGL01790:Rasal1 APN 5 120670318 missense possibly damaging 0.61
IGL01866:Rasal1 APN 5 120675423 missense probably damaging 1.00
IGL02143:Rasal1 APN 5 120652852 missense probably damaging 1.00
IGL02527:Rasal1 APN 5 120666404 missense probably damaging 0.98
IGL02565:Rasal1 APN 5 120676780 splice site probably benign
IGL02710:Rasal1 APN 5 120666431 missense possibly damaging 0.71
PIT4618001:Rasal1 UTSW 5 120670376 missense probably damaging 0.99
R0270:Rasal1 UTSW 5 120674729 missense probably damaging 0.97
R0281:Rasal1 UTSW 5 120674605 missense probably benign
R0673:Rasal1 UTSW 5 120670384 missense probably benign 0.26
R1227:Rasal1 UTSW 5 120670307 missense probably damaging 0.99
R1475:Rasal1 UTSW 5 120662982 missense possibly damaging 0.55
R1486:Rasal1 UTSW 5 120654852 missense probably damaging 1.00
R1557:Rasal1 UTSW 5 120676849 missense possibly damaging 0.87
R1651:Rasal1 UTSW 5 120652845 nonsense probably null
R1792:Rasal1 UTSW 5 120664756 missense probably benign 0.06
R2148:Rasal1 UTSW 5 120662031 missense probably damaging 0.97
R2964:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2983:Rasal1 UTSW 5 120654862 missense probably benign 0.45
R4090:Rasal1 UTSW 5 120675609 missense possibly damaging 0.95
R4205:Rasal1 UTSW 5 120659563 missense probably benign 0.21
R4643:Rasal1 UTSW 5 120678964 missense probably benign 0.05
R4979:Rasal1 UTSW 5 120678676 missense probably benign
R5171:Rasal1 UTSW 5 120663764 missense probably benign
R5187:Rasal1 UTSW 5 120675395 missense probably benign 0.13
R5877:Rasal1 UTSW 5 120679070 utr 3 prime probably benign
R5924:Rasal1 UTSW 5 120675517 missense probably damaging 1.00
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6136:Rasal1 UTSW 5 120675478 missense possibly damaging 0.84
R6159:Rasal1 UTSW 5 120659608 missense probably damaging 1.00
R6292:Rasal1 UTSW 5 120659620 missense probably damaging 0.97
R6548:Rasal1 UTSW 5 120674725 missense probably benign 0.00
X0057:Rasal1 UTSW 5 120664512 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTGATAGAAATGGGCAGTGC -3'
(R):5'- TGCAGGTCCAGAGTTTTAGTACTG -3'

Sequencing Primer
(F):5'- TCATCTGGGCAGGAGCTG -3'
(R):5'- AGGACTCACCCTCATCCT -3'
Posted On2015-02-05