Mutagenetix > Incidental Mutation

Incidental Mutation 'R3030:Aimp2'

264690

Institutional Source

Beutler Lab

Gene Symbol

Aimp2

Ensembl Gene

ENSMUSG00000029610

Gene Name

aminoacyl tRNA synthetase complex-interacting multifunctional protein 2

Synonyms

Jtv1, Aimp2(p38)

MMRRC Submission

040546-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3030 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

143839522-143846657 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143843509 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 27 (Y27C)

Ref Sequence

ENSEMBL: ENSMUSP00000098052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031613] [ENSMUST00000100483] [ENSMUST00000100487] [ENSMUST00000110709] [ENSMUST00000148011]

AlphaFold

Q8R010

Predicted Effect

probably damaging
Transcript: ENSMUST00000031613
AA Change: Y67C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031613
Gene: ENSMUSG00000029610
AA Change: Y67C

Domain	Start	End	E-Value	Type
Pfam:AIMP2_LysRS_bd	1	44	8.3e-26	PFAM
low complexity region	133	142	N/A	INTRINSIC
Pfam:GST_C_3	231	308	2.5e-10	PFAM
Pfam:GST_C	242	310	5e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000100483
AA Change: Y27C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098052
Gene: ENSMUSG00000029610
AA Change: Y27C

Domain	Start	End	E-Value	Type
low complexity region	93	102	N/A	INTRINSIC
Pfam:GST_C_3	185	268	1.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100487

SMART Domains

Protein: ENSMUSP00000098056
Gene: ENSMUSG00000029613

Domain	Start	End	E-Value	Type
low complexity region	12	28	N/A	INTRINSIC
low complexity region	62	81	N/A	INTRINSIC
Pfam:Pkinase_Tyr	167	242	5.6e-6	PFAM
Pfam:Pkinase	167	257	1.9e-15	PFAM
low complexity region	314	320	N/A	INTRINSIC
Pfam:Pkinase	365	580	1.3e-31	PFAM
Pfam:Pkinase_Tyr	373	578	1.9e-19	PFAM
coiled coil region	585	619	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110707

Predicted Effect

probably benign
Transcript: ENSMUST00000110709

SMART Domains

Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109

Domain	Start	End	E-Value	Type
HATPase_c	30	165	3.77e-1	SMART
MutL_C	277	421	1.59e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110710

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128440

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128153

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154781

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168085

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147910

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170083

Predicted Effect

probably benign
Transcript: ENSMUST00000148011

SMART Domains

Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109

Domain	Start	End	E-Value	Type
HATPase_c	30	165	3.77e-1	SMART
DNA_mis_repair	227	364	4.76e-41	SMART
MutL_C	675	819	1.59e-36	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the aminoacyl-tRNA synthetase complex, which contains nine different aminoacyl-tRNA synthetases and three non-enzymatic factors. The encoded protein is one of the non-enzymatic factors and is required for assembly and stability of the complex. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele are born with no apparent phenotype but die within 2 days of birth of unknown causes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	C	T	16: 56,477,682 (GRCm39)	H1202Y	possibly damaging	Het
Acad8	G	T	9: 26,890,355 (GRCm39)	H287N	probably benign	Het
Cd59a	A	T	2: 103,941,160 (GRCm39)	D46V	probably benign	Het
Cdh15	G	A	8: 123,588,763 (GRCm39)	R279Q	probably damaging	Het
Cyp4f17	T	C	17: 32,725,950 (GRCm39)	S28P	possibly damaging	Het
Dytn	T	A	1: 63,672,678 (GRCm39)	E575V	probably benign	Het
F11	A	G	8: 45,701,675 (GRCm39)	S353P	probably damaging	Het
Fbln2	G	A	6: 91,210,697 (GRCm39)	E214K	probably damaging	Het
H2-M11	C	T	17: 36,859,042 (GRCm39)	T194I	possibly damaging	Het
Helb	A	T	10: 119,925,487 (GRCm39)	C963*	probably null	Het
Hspb1	C	T	5: 135,918,267 (GRCm39)	Q205*	probably null	Het
Itpkc	G	A	7: 26,911,733 (GRCm39)		probably null	Het
Kndc1	G	T	7: 139,481,123 (GRCm39)	A70S	probably damaging	Het
Mrc2	G	A	11: 105,239,257 (GRCm39)		probably null	Het
Nlrp2	G	A	7: 5,330,747 (GRCm39)	R550C	probably damaging	Het
Plin3	T	C	17: 56,591,184 (GRCm39)	K199E	possibly damaging	Het
Plod3	G	C	5: 137,017,000 (GRCm39)	A50P	probably benign	Het
Ppp4r4	A	G	12: 103,573,215 (GRCm39)	M705V	probably benign	Het
Slc22a3	T	C	17: 12,676,521 (GRCm39)	I291V	probably benign	Het
Smarca2	A	C	19: 26,729,429 (GRCm39)	N100T	possibly damaging	Het
Tmem260	T	C	14: 48,722,458 (GRCm39)	F331S	probably damaging	Het
Trank1	A	G	9: 111,220,598 (GRCm39)	Q2445R	possibly damaging	Het
Umod	A	G	7: 119,076,062 (GRCm39)	S235P	probably benign	Het
Vdr	T	C	15: 97,755,444 (GRCm39)	T360A	probably benign	Het
Vmn1r76	A	G	7: 11,664,402 (GRCm39)	S236P	probably damaging	Het

Other mutations in Aimp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Aimp2	APN	5	143,843,524 (GRCm39)	missense	probably damaging	1.00
R0630:Aimp2	UTSW	5	143,843,419 (GRCm39)	missense	probably benign	0.00
R1185:Aimp2	UTSW	5	143,841,509 (GRCm39)	missense	possibly damaging	0.82
R1185:Aimp2	UTSW	5	143,841,509 (GRCm39)	missense	possibly damaging	0.82
R1185:Aimp2	UTSW	5	143,841,509 (GRCm39)	missense	possibly damaging	0.82
R1992:Aimp2	UTSW	5	143,843,548 (GRCm39)	missense	probably damaging	1.00
R2888:Aimp2	UTSW	5	143,846,553 (GRCm39)	unclassified	probably benign
R3782:Aimp2	UTSW	5	143,843,517 (GRCm39)	missense	possibly damaging	0.54
R5510:Aimp2	UTSW	5	143,843,347 (GRCm39)	unclassified	probably benign
R5689:Aimp2	UTSW	5	143,843,389 (GRCm39)	missense	possibly damaging	0.51
R8019:Aimp2	UTSW	5	143,846,412 (GRCm39)	missense	probably benign	0.01
R8777:Aimp2	UTSW	5	143,839,825 (GRCm39)	missense	probably damaging	0.99
R8777-TAIL:Aimp2	UTSW	5	143,839,825 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTTTGGCACTCATAGACATCTGG -3'
(R):5'- AGGTCATCCTGAACAACACG -3'

Sequencing Primer
(F):5'- GGCACTCATAGACATCTGGTTTCTC -3'
(R):5'- CCTACCATAGCATGCATGTGGAG -3'

Posted On

2015-02-05