Incidental Mutation 'R3030:Acad8'
ID264699
Institutional Source Beutler Lab
Gene Symbol Acad8
Ensembl Gene ENSMUSG00000031969
Gene Nameacyl-Coenzyme A dehydrogenase family, member 8
Synonyms
MMRRC Submission 040546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R3030 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location26974135-26999566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26979059 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 287 (H287N)
Ref Sequence ENSEMBL: ENSMUSP00000112908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060513] [ENSMUST00000120367] [ENSMUST00000128923] [ENSMUST00000132293]
Predicted Effect probably benign
Transcript: ENSMUST00000060513
AA Change: H287N

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000054370
Gene: ENSMUSG00000031969
AA Change: H287N

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 40 151 1e-28 PFAM
Pfam:Acyl-CoA_dh_M 155 207 1.8e-23 PFAM
Pfam:Acyl-CoA_dh_1 261 411 2.9e-47 PFAM
Pfam:Acyl-CoA_dh_2 276 399 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120367
AA Change: H287N

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112908
Gene: ENSMUSG00000031969
AA Change: H287N

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 40 151 7.8e-29 PFAM
Pfam:Acyl-CoA_dh_M 155 249 3.7e-28 PFAM
Pfam:Acyl-CoA_dh_1 261 411 5.7e-45 PFAM
Pfam:Acyl-CoA_dh_2 276 400 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129490
Predicted Effect probably benign
Transcript: ENSMUST00000132293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151075
Predicted Effect probably benign
Transcript: ENSMUST00000215693
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. The encoded protein is a mitochondrial enzyme that functions in catabolism of the branched-chain amino acid valine. Defects in this gene are the cause of isobutyryl-CoA dehydrogenase deficiency.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cold intolerance at young age with a progressive hepatic steatosis and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,657,319 H1202Y possibly damaging Het
Aimp2 T C 5: 143,906,691 Y27C probably damaging Het
Cd59a A T 2: 104,110,815 D46V probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cyp4f17 T C 17: 32,506,976 S28P possibly damaging Het
Dytn T A 1: 63,633,519 E575V probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbln2 G A 6: 91,233,715 E214K probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Helb A T 10: 120,089,582 C963* probably null Het
Hspb1 C T 5: 135,889,413 Q205* probably null Het
Itpkc G A 7: 27,212,308 probably null Het
Kndc1 G T 7: 139,901,207 A70S probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp2 G A 7: 5,327,748 R550C probably damaging Het
Plin3 T C 17: 56,284,184 K199E possibly damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ppp4r4 A G 12: 103,606,956 M705V probably benign Het
Slc22a3 T C 17: 12,457,634 I291V probably benign Het
Smarca2 A C 19: 26,752,029 N100T possibly damaging Het
Tmem260 T C 14: 48,485,001 F331S probably damaging Het
Trank1 A G 9: 111,391,530 Q2445R possibly damaging Het
Umod A G 7: 119,476,839 S235P probably benign Het
Vdr T C 15: 97,857,563 T360A probably benign Het
Vmn1r76 A G 7: 11,930,475 S236P probably damaging Het
Other mutations in Acad8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Acad8 APN 9 26990594 missense probably damaging 1.00
IGL01721:Acad8 APN 9 26992267 splice site probably benign
R1473:Acad8 UTSW 9 26979041 missense probably benign 0.00
R2102:Acad8 UTSW 9 26985565 nonsense probably null
R4023:Acad8 UTSW 9 26979185 missense probably benign 0.02
R4276:Acad8 UTSW 9 26978449 missense probably null 0.47
R4667:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4668:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4669:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4898:Acad8 UTSW 9 26978402 missense probably damaging 1.00
R5418:Acad8 UTSW 9 26985557 missense probably damaging 1.00
R5486:Acad8 UTSW 9 26999495 start codon destroyed probably null
R5549:Acad8 UTSW 9 26985551 missense probably damaging 1.00
R5887:Acad8 UTSW 9 26979324 splice site probably null
R5943:Acad8 UTSW 9 26999444 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGTGGCACAGGTACATGC -3'
(R):5'- AGGGTTTTCTCATCGCCATG -3'

Sequencing Primer
(F):5'- AAGATGGTAGCAAGTTCTTCACTGG -3'
(R):5'- GGTTTTCTCATCGCCATGAAAGGAC -3'
Posted On2015-02-05