Incidental Mutation 'R0344:Colec12'
ID26472
Institutional Source Beutler Lab
Gene Symbol Colec12
Ensembl Gene ENSMUSG00000036103
Gene Namecollectin sub-family member 12
SynonymsCL-P1, SRCL, Scara4
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location9707648-9877995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9858921 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 568 (P568L)
Ref Sequence ENSEMBL: ENSMUSP00000043220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040069]
PDB Structure
Mouse Scavenger Receptor C-type Lectin carbohydrate-recognition domain. [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000040069
AA Change: P568L
SMART Domains Protein: ENSMUSP00000043220
Gene: ENSMUSG00000036103
AA Change: P568L

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 112 157 N/A INTRINSIC
low complexity region 205 211 N/A INTRINSIC
coiled coil region 217 247 N/A INTRINSIC
low complexity region 268 280 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
Pfam:Collagen 441 499 1.4e-10 PFAM
Pfam:Collagen 482 548 9.6e-10 PFAM
Pfam:Collagen 530 591 3.8e-11 PFAM
CLECT 607 731 4.19e-36 SMART
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. This protein is a scavenger receptor, a cell surface glycoprotein that displays several functions associated with host defense. It can bind to carbohydrate antigens on microorganisms, facilitating their recognition and removal. It also mediates the recognition, internalization, and degradation of oxidatively modified low density lipoprotein by vascular endothelial cells. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Colec12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Colec12 APN 18 9848826 missense probably damaging 1.00
IGL02477:Colec12 APN 18 9859858 missense unknown
R0128:Colec12 UTSW 18 9858921 missense unknown
R0130:Colec12 UTSW 18 9858921 missense unknown
R0178:Colec12 UTSW 18 9858921 missense unknown
R0179:Colec12 UTSW 18 9858921 missense unknown
R0180:Colec12 UTSW 18 9848890 missense probably damaging 0.99
R0180:Colec12 UTSW 18 9858921 missense unknown
R0318:Colec12 UTSW 18 9848446 missense possibly damaging 0.77
R0573:Colec12 UTSW 18 9858650 missense probably damaging 0.97
R1028:Colec12 UTSW 18 9866837 missense unknown
R1693:Colec12 UTSW 18 9866765 missense unknown
R1951:Colec12 UTSW 18 9859975 critical splice donor site probably null
R2008:Colec12 UTSW 18 9874813 missense probably benign 0.03
R2181:Colec12 UTSW 18 9846828 missense probably damaging 0.99
R4258:Colec12 UTSW 18 9720950 missense probably damaging 1.00
R4794:Colec12 UTSW 18 9848984 missense probably damaging 0.99
R5269:Colec12 UTSW 18 9846825 missense possibly damaging 0.67
R5369:Colec12 UTSW 18 9866750 missense unknown
R5421:Colec12 UTSW 18 9858580 missense probably damaging 1.00
R5608:Colec12 UTSW 18 9848267 missense possibly damaging 0.95
R5668:Colec12 UTSW 18 9848963 missense probably damaging 1.00
R5684:Colec12 UTSW 18 9849009 missense probably damaging 0.99
R6547:Colec12 UTSW 18 9840351 missense probably damaging 1.00
R7194:Colec12 UTSW 18 9848248 missense probably benign 0.08
R7253:Colec12 UTSW 18 9848922 missense probably damaging 1.00
Z1088:Colec12 UTSW 18 9848727 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACCTGGTCCAACTGGCAACAAG -3'
(R):5'- GCCAAGCCTACACACTGCCTTATTC -3'

Sequencing Primer
(F):5'- GGCACAATTGGACCAGTCG -3'
(R):5'- TTCCTCCACAATTCTAGCTGAGAAG -3'
Posted On2013-04-16