Incidental Mutation 'R3032:Ddx41'
ID 264757
Institutional Source Beutler Lab
Gene Symbol Ddx41
Ensembl Gene ENSMUSG00000021494
Gene Name DEAD box helicase 41
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 41, 2900024F02Rik
MMRRC Submission 040548-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3032 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 55678223-55684471 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55682293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 205 (R205W)
Ref Sequence ENSEMBL: ENSMUSP00000153348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021956] [ENSMUST00000021957] [ENSMUST00000224765]
AlphaFold Q91VN6
Predicted Effect possibly damaging
Transcript: ENSMUST00000021956
AA Change: R194W

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021956
Gene: ENSMUSG00000021494
AA Change: R194W

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 39 56 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
DEXDc 200 411 8.56e-53 SMART
HELICc 446 527 5.99e-34 SMART
ZnF_C2HC 581 597 1.98e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021957
SMART Domains Protein: ENSMUSP00000021957
Gene: ENSMUSG00000021495

DomainStartEndE-ValueType
low complexity region 55 71 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
low complexity region 161 174 N/A INTRINSIC
low complexity region 198 242 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
coiled coil region 371 404 N/A INTRINSIC
low complexity region 566 573 N/A INTRINSIC
low complexity region 622 635 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Pfam:FAM193_C 722 776 9.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224686
Predicted Effect possibly damaging
Transcript: ENSMUST00000224765
AA Change: R205W

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225703
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD box protein family and interacts with several spliceosomal proteins. In addition, the encoded protein may recognize the bacterial second messengers cyclic di-GMP and cyclic di-AMP, resulting in the induction of genes involved in the innate immune response. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 A T 14: 8,253,466 (GRCm38) L227Q probably damaging Het
Dpysl4 A G 7: 138,676,152 (GRCm39) N315D probably benign Het
Eps8 A T 6: 137,489,175 (GRCm39) S408T probably damaging Het
F13b A C 1: 139,445,071 (GRCm39) T574P probably damaging Het
Fgfrl1 A G 5: 108,853,926 (GRCm39) I344M probably benign Het
Or5b21 G A 19: 12,839,282 (GRCm39) V48I probably benign Het
Park7 T C 4: 150,985,509 (GRCm39) K122R probably benign Het
Psg18 G A 7: 18,084,904 (GRCm39) S64L probably benign Het
Rhbdf1 T C 11: 32,159,985 (GRCm39) D172G probably damaging Het
Serpinb6b G A 13: 33,152,551 (GRCm39) G20D possibly damaging Het
Sorcs1 G A 19: 50,213,613 (GRCm39) R705C probably damaging Het
Syt14 A T 1: 192,669,059 (GRCm39) Y65N possibly damaging Het
Tll1 T C 8: 64,551,526 (GRCm39) N285S probably damaging Het
Umodl1 G A 17: 31,208,502 (GRCm39) R849Q probably benign Het
Upf1 C T 8: 70,791,110 (GRCm39) R544H probably damaging Het
Other mutations in Ddx41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ddx41 APN 13 55,679,212 (GRCm39) missense probably damaging 1.00
IGL00516:Ddx41 APN 13 55,680,280 (GRCm39) missense probably damaging 0.96
IGL02383:Ddx41 APN 13 55,680,170 (GRCm39) missense probably benign 0.04
R0081:Ddx41 UTSW 13 55,683,193 (GRCm39) missense possibly damaging 0.58
R0097:Ddx41 UTSW 13 55,683,691 (GRCm39) splice site probably benign
R0412:Ddx41 UTSW 13 55,678,421 (GRCm39) missense probably damaging 0.99
R0597:Ddx41 UTSW 13 55,680,819 (GRCm39) missense probably damaging 1.00
R0699:Ddx41 UTSW 13 55,679,112 (GRCm39) splice site probably benign
R1330:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R1812:Ddx41 UTSW 13 55,683,767 (GRCm39) missense probably benign 0.03
R2011:Ddx41 UTSW 13 55,681,906 (GRCm39) splice site probably null
R2224:Ddx41 UTSW 13 55,679,214 (GRCm39) missense probably damaging 1.00
R2310:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R2311:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R2355:Ddx41 UTSW 13 55,682,113 (GRCm39) missense probably benign 0.03
R2983:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3764:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3773:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3916:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3926:Ddx41 UTSW 13 55,679,083 (GRCm39) missense probably damaging 1.00
R4153:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4154:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4372:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4470:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4519:Ddx41 UTSW 13 55,680,957 (GRCm39) missense probably damaging 1.00
R4569:Ddx41 UTSW 13 55,683,834 (GRCm39) missense possibly damaging 0.88
R4823:Ddx41 UTSW 13 55,679,868 (GRCm39) missense probably benign 0.02
R4837:Ddx41 UTSW 13 55,679,461 (GRCm39) missense possibly damaging 0.95
R5443:Ddx41 UTSW 13 55,683,104 (GRCm39) missense probably benign 0.00
R5642:Ddx41 UTSW 13 55,683,708 (GRCm39) missense possibly damaging 0.86
R5926:Ddx41 UTSW 13 55,682,112 (GRCm39) missense probably damaging 0.99
R5949:Ddx41 UTSW 13 55,679,874 (GRCm39) missense probably damaging 1.00
R6035:Ddx41 UTSW 13 55,681,781 (GRCm39) missense probably benign 0.00
R6035:Ddx41 UTSW 13 55,681,781 (GRCm39) missense probably benign 0.00
R7254:Ddx41 UTSW 13 55,681,769 (GRCm39) nonsense probably null
R7640:Ddx41 UTSW 13 55,682,052 (GRCm39) missense possibly damaging 0.81
R7803:Ddx41 UTSW 13 55,679,734 (GRCm39) missense probably damaging 1.00
R8690:Ddx41 UTSW 13 55,680,939 (GRCm39) missense probably damaging 1.00
R8714:Ddx41 UTSW 13 55,682,250 (GRCm39) missense probably damaging 1.00
R9071:Ddx41 UTSW 13 55,680,219 (GRCm39) missense probably damaging 0.96
R9089:Ddx41 UTSW 13 55,683,424 (GRCm39) missense probably benign 0.05
R9312:Ddx41 UTSW 13 55,683,842 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGAATACCAGTGTCTTGCC -3'
(R):5'- CTGCTTCAACAGAGCTTCCATG -3'

Sequencing Primer
(F):5'- AATGCCGATCATGTCCCG -3'
(R):5'- TTCCATGAGAACTTAGGCCCAGTG -3'
Posted On 2015-02-05