Incidental Mutation 'R3034:Cd40'
ID 264769
Institutional Source Beutler Lab
Gene Symbol Cd40
Ensembl Gene ENSMUSG00000017652
Gene Name CD40 antigen
Synonyms Tnfrsf5, p50, Bp50, Cd40
MMRRC Submission 040550-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3034 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 164897535-164913574 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 164904235 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 65 (S65R)
Ref Sequence ENSEMBL: ENSMUSP00000122981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017799] [ENSMUST00000073707] [ENSMUST00000081310] [ENSMUST00000140951] [ENSMUST00000154443] [ENSMUST00000184221]
AlphaFold P27512
Predicted Effect probably benign
Transcript: ENSMUST00000017799
AA Change: S27R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017799
Gene: ENSMUSG00000017652
AA Change: S27R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073707
AA Change: S27R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073386
Gene: ENSMUSG00000017652
AA Change: S27R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081310
AA Change: S27R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080059
Gene: ENSMUSG00000017652
AA Change: S27R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140951
AA Change: S65R

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122981
Gene: ENSMUSG00000017652
AA Change: S65R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TNFR 64 97 9.45e-6 SMART
Blast:TNFR 100 121 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153105
Predicted Effect probably benign
Transcript: ENSMUST00000154443
Predicted Effect probably benign
Transcript: ENSMUST00000184221
AA Change: S27R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139193
Gene: ENSMUSG00000017652
AA Change: S27R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene may cause impaired immunoglobulin class switching and germinal center formation, reduced susceptibility to type II hypersensitivity reaction, impaired priming of T cells and control of M. tuberculosis infection, and altered response to transplant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,207,079 (GRCm39) I576V probably benign Het
Apol7a T G 15: 77,273,923 (GRCm39) I180L probably benign Het
Aptx T C 4: 40,694,994 (GRCm39) N114S probably benign Het
Bltp3a T A 17: 28,113,720 (GRCm39) D1297E probably damaging Het
Cdh23 C T 10: 60,244,789 (GRCm39) probably benign Het
Coro7 G A 16: 4,450,155 (GRCm39) R565W probably damaging Het
Cpt1a C T 19: 3,428,390 (GRCm39) T588M probably damaging Het
Defb23 A G 2: 152,301,189 (GRCm39) S128P possibly damaging Het
Dgki G A 6: 37,064,605 (GRCm39) H250Y probably damaging Het
Fgr T C 4: 132,725,807 (GRCm39) probably null Het
Fkbp15 T C 4: 62,225,129 (GRCm39) probably null Het
Gpr137c C T 14: 45,457,733 (GRCm39) S95L probably damaging Het
Kirrel1 T C 3: 86,990,746 (GRCm39) D692G possibly damaging Het
Krt1 C A 15: 101,759,068 (GRCm39) R32L unknown Het
Lama2 C T 10: 26,877,231 (GRCm39) E2652K probably benign Het
Mbl1 C A 14: 40,880,790 (GRCm39) S226Y probably damaging Het
Mrps28 T A 3: 8,988,675 (GRCm39) D61V probably benign Het
Mthfd1 A G 12: 76,336,244 (GRCm39) K299E probably benign Het
Myo1b A G 1: 51,812,406 (GRCm39) Y738H possibly damaging Het
Myo5c A G 9: 75,193,859 (GRCm39) T1205A probably benign Het
Nfatc2 C T 2: 168,376,940 (GRCm39) G317S probably damaging Het
Nln C T 13: 104,173,947 (GRCm39) V525I possibly damaging Het
Nrap T C 19: 56,352,437 (GRCm39) E549G probably damaging Het
Nwd2 T A 5: 63,957,446 (GRCm39) Y259N probably damaging Het
Oas3 T C 5: 120,909,121 (GRCm39) D275G probably damaging Het
Or14a256 A T 7: 86,264,970 (GRCm39) D294E possibly damaging Het
Ovch2 A G 7: 107,384,699 (GRCm39) S473P probably damaging Het
Pde8b T A 13: 95,359,275 (GRCm39) Y16F probably damaging Het
Pmfbp1 A T 8: 110,247,553 (GRCm39) probably null Het
Pmvk T C 3: 89,375,824 (GRCm39) V74A probably damaging Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rbm26 T A 14: 105,390,881 (GRCm39) T202S unknown Het
Rheb C T 5: 25,008,721 (GRCm39) E166K probably damaging Het
Rnf5 A G 17: 34,822,332 (GRCm39) V39A possibly damaging Het
Scn7a T C 2: 66,513,152 (GRCm39) Y1168C probably damaging Het
Tas2r114 A G 6: 131,666,611 (GRCm39) I139T probably benign Het
Tma7 T C 9: 108,911,274 (GRCm39) probably benign Het
Tmem181a T A 17: 6,330,901 (GRCm39) S13T possibly damaging Het
Tmem62 C T 2: 120,809,605 (GRCm39) probably benign Het
Trim71 T C 9: 114,341,912 (GRCm39) D790G probably damaging Het
Trp53tg5 T C 2: 164,313,219 (GRCm39) K152R probably benign Het
Zdbf2 C A 1: 63,343,364 (GRCm39) A581E probably damaging Het
Other mutations in Cd40
AlleleSourceChrCoordTypePredicted EffectPPH Score
bluebonnet UTSW 2 164,904,221 (GRCm39) missense probably benign 0.23
noelle UTSW 2 164,905,483 (GRCm39) critical splice donor site probably null
R0553:Cd40 UTSW 2 164,912,661 (GRCm39) missense probably benign 0.01
R1115:Cd40 UTSW 2 164,912,681 (GRCm39) missense possibly damaging 0.59
R1134:Cd40 UTSW 2 164,912,738 (GRCm39) missense probably benign 0.44
R2036:Cd40 UTSW 2 164,904,221 (GRCm39) missense probably benign 0.23
R2938:Cd40 UTSW 2 164,911,622 (GRCm39) missense probably benign 0.01
R4690:Cd40 UTSW 2 164,911,615 (GRCm39) missense possibly damaging 0.68
R5222:Cd40 UTSW 2 164,908,464 (GRCm39) missense probably benign 0.41
R5310:Cd40 UTSW 2 164,905,483 (GRCm39) critical splice donor site probably null
R7318:Cd40 UTSW 2 164,904,255 (GRCm39) missense possibly damaging 0.51
R7833:Cd40 UTSW 2 164,908,431 (GRCm39) missense probably benign 0.01
R7905:Cd40 UTSW 2 164,904,245 (GRCm39) missense probably damaging 1.00
R8069:Cd40 UTSW 2 164,898,695 (GRCm39) missense unknown
R8371:Cd40 UTSW 2 164,908,458 (GRCm39) missense probably damaging 1.00
R9177:Cd40 UTSW 2 164,905,465 (GRCm39) missense probably damaging 1.00
R9224:Cd40 UTSW 2 164,898,716 (GRCm39) missense unknown
R9311:Cd40 UTSW 2 164,912,667 (GRCm39) missense possibly damaging 0.87
R9419:Cd40 UTSW 2 164,904,162 (GRCm39) intron probably benign
R9625:Cd40 UTSW 2 164,905,061 (GRCm39) missense probably benign
Z1088:Cd40 UTSW 2 164,904,960 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCCTGTGCATCTGTTCGG -3'
(R):5'- TGGGGTATTCTGGCATCAAG -3'

Sequencing Primer
(F):5'- GCTTTGGTAGATGGCAGTAAGAC -3'
(R):5'- TATTCTGGCATCAAGGAAGAGG -3'
Posted On 2015-02-05