Incidental Mutation 'R3034:Fgr'
ID264777
Institutional Source Beutler Lab
Gene Symbol Fgr
Ensembl Gene ENSMUSG00000028874
Gene NameFGR proto-oncogene, Src family tyrosine kinase
Synonyms
MMRRC Submission 040550-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R3034 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132974095-133001910 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 132998496 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030693] [ENSMUST00000171223]
Predicted Effect probably null
Transcript: ENSMUST00000030693
SMART Domains Protein: ENSMUSP00000030693
Gene: ENSMUSG00000028874

DomainStartEndE-ValueType
SH3 68 125 5.39e-22 SMART
SH2 130 220 5.25e-36 SMART
TyrKc 251 500 5.5e-126 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138179
Predicted Effect probably null
Transcript: ENSMUST00000171223
SMART Domains Protein: ENSMUSP00000128411
Gene: ENSMUSG00000028874

DomainStartEndE-ValueType
SH3 68 125 5.39e-22 SMART
SH2 130 220 5.25e-36 SMART
TyrKc 251 500 5.5e-126 SMART
Meta Mutation Damage Score 0.498 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to plasma membrane ruffles, and functions as a negative regulator of cell migration and adhesion triggered by the beta-2 integrin signal transduction pathway. Infection with Epstein-Barr virus results in the overexpression of this gene. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial reduction in hemorrhage following induction of a local Shwartzman reaction, and show enhanced NK-cell receptor-induced IFN-gamma production in natural killer (NK) cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,316,253 I576V probably benign Het
Apol7a T G 15: 77,389,723 I180L probably benign Het
Aptx T C 4: 40,694,994 N114S probably benign Het
Cd40 T A 2: 165,062,315 S65R probably benign Het
Cdh23 C T 10: 60,409,010 probably benign Het
Coro7 G A 16: 4,632,291 R565W probably damaging Het
Cpt1a C T 19: 3,378,390 T588M probably damaging Het
Defb23 A G 2: 152,459,269 S128P possibly damaging Het
Dgki G A 6: 37,087,670 H250Y probably damaging Het
Fkbp15 T C 4: 62,306,892 probably null Het
Gpr137c C T 14: 45,220,276 S95L probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Krt1 C A 15: 101,850,633 R32L unknown Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mrps28 T A 3: 8,923,615 D61V probably benign Het
Mthfd1 A G 12: 76,289,470 K299E probably benign Het
Myo1b A G 1: 51,773,247 Y738H possibly damaging Het
Myo5c A G 9: 75,286,577 T1205A probably benign Het
Nfatc2 C T 2: 168,535,020 G317S probably damaging Het
Nln C T 13: 104,037,439 V525I possibly damaging Het
Nrap T C 19: 56,364,005 E549G probably damaging Het
Nwd2 T A 5: 63,800,103 Y259N probably damaging Het
Oas3 T C 5: 120,771,056 D275G probably damaging Het
Olfr294 A T 7: 86,615,762 D294E possibly damaging Het
Ovch2 A G 7: 107,785,492 S473P probably damaging Het
Pde8b T A 13: 95,222,767 Y16F probably damaging Het
Pmfbp1 A T 8: 109,520,921 probably null Het
Pmvk T C 3: 89,468,517 V74A probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,153,445 T202S unknown Het
Rheb C T 5: 24,803,723 E166K probably damaging Het
Rnf5 A G 17: 34,603,358 V39A possibly damaging Het
Scn7a T C 2: 66,682,808 Y1168C probably damaging Het
Tas2r114 A G 6: 131,689,648 I139T probably benign Het
Tma7 T C 9: 109,082,206 probably benign Het
Tmem181a T A 17: 6,280,626 S13T possibly damaging Het
Tmem62 C T 2: 120,979,124 probably benign Het
Trim71 T C 9: 114,512,844 D790G probably damaging Het
Trp53tg5 T C 2: 164,471,299 K152R probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Zdbf2 C A 1: 63,304,205 A581E probably damaging Het
Other mutations in Fgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02201:Fgr APN 4 132994924 missense probably damaging 0.99
IGL03089:Fgr APN 4 132986266 missense probably damaging 0.96
R1760:Fgr UTSW 4 132998342 missense possibly damaging 0.72
R1957:Fgr UTSW 4 132998362 missense probably benign
R2011:Fgr UTSW 4 132997521 missense probably damaging 1.00
R2109:Fgr UTSW 4 132998475 missense probably benign 0.32
R2351:Fgr UTSW 4 132997237 missense probably damaging 0.99
R2941:Fgr UTSW 4 132998423 missense probably benign
R4590:Fgr UTSW 4 132995053 missense probably damaging 1.00
R4770:Fgr UTSW 4 132987291 missense probably damaging 0.99
R4847:Fgr UTSW 4 132994648 missense probably damaging 1.00
R5294:Fgr UTSW 4 132997500 missense probably benign 0.01
R5384:Fgr UTSW 4 132986353 critical splice donor site probably null
R5388:Fgr UTSW 4 132995031 missense probably damaging 1.00
R5650:Fgr UTSW 4 133000222 missense probably benign 0.13
R6947:Fgr UTSW 4 132995069 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTAGCACCTGCCTCTCAC -3'
(R):5'- GCAGTGCCTGATACTTACTAAGTAG -3'

Sequencing Primer
(F):5'- ACCTGCCTCTCACTTCCTTTC -3'
(R):5'- CATTACAGATGGTTGTGAGCCACC -3'
Posted On2015-02-05