Incidental Mutation 'R3034:Gpr137c'
ID264796
Institutional Source Beutler Lab
Gene Symbol Gpr137c
Ensembl Gene ENSMUSG00000049092
Gene NameG protein-coupled receptor 137C
SynonymsLOC380893, 6330416L11Rik, TM7SF1L2
MMRRC Submission 040550-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R3034 (G1)
Quality Score215
Status Validated
Chromosome14
Chromosomal Location45219717-45282725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45220276 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 95 (S95L)
Ref Sequence ENSEMBL: ENSMUSP00000154316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022377] [ENSMUST00000123879] [ENSMUST00000128484] [ENSMUST00000139526] [ENSMUST00000143609] [ENSMUST00000146150] [ENSMUST00000147853] [ENSMUST00000147957] [ENSMUST00000153383] [ENSMUST00000226879] [ENSMUST00000227009] [ENSMUST00000227056] [ENSMUST00000227086]
Predicted Effect probably benign
Transcript: ENSMUST00000022377
SMART Domains Protein: ENSMUSP00000022377
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123118
Predicted Effect probably benign
Transcript: ENSMUST00000123879
SMART Domains Protein: ENSMUSP00000123023
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128484
Predicted Effect probably benign
Transcript: ENSMUST00000139526
SMART Domains Protein: ENSMUSP00000120287
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1e-12 PFAM
Pfam:Thioredoxin_6 534 723 7.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143609
SMART Domains Protein: ENSMUSP00000122128
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146150
AA Change: S95L

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120015
Gene: ENSMUSG00000049092
AA Change: S95L

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 23 39 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Blast:G_alpha 121 286 9e-17 BLAST
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147853
Predicted Effect probably damaging
Transcript: ENSMUST00000147957
AA Change: S95L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150648
Predicted Effect probably benign
Transcript: ENSMUST00000153383
Predicted Effect probably benign
Transcript: ENSMUST00000226879
Predicted Effect silent
Transcript: ENSMUST00000226915
Predicted Effect probably damaging
Transcript: ENSMUST00000227009
AA Change: S95L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227056
AA Change: S87L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227086
AA Change: S95L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.0924 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,316,253 I576V probably benign Het
Apol7a T G 15: 77,389,723 I180L probably benign Het
Aptx T C 4: 40,694,994 N114S probably benign Het
Cd40 T A 2: 165,062,315 S65R probably benign Het
Cdh23 C T 10: 60,409,010 probably benign Het
Coro7 G A 16: 4,632,291 R565W probably damaging Het
Cpt1a C T 19: 3,378,390 T588M probably damaging Het
Defb23 A G 2: 152,459,269 S128P possibly damaging Het
Dgki G A 6: 37,087,670 H250Y probably damaging Het
Fgr T C 4: 132,998,496 probably null Het
Fkbp15 T C 4: 62,306,892 probably null Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Krt1 C A 15: 101,850,633 R32L unknown Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mrps28 T A 3: 8,923,615 D61V probably benign Het
Mthfd1 A G 12: 76,289,470 K299E probably benign Het
Myo1b A G 1: 51,773,247 Y738H possibly damaging Het
Myo5c A G 9: 75,286,577 T1205A probably benign Het
Nfatc2 C T 2: 168,535,020 G317S probably damaging Het
Nln C T 13: 104,037,439 V525I possibly damaging Het
Nrap T C 19: 56,364,005 E549G probably damaging Het
Nwd2 T A 5: 63,800,103 Y259N probably damaging Het
Oas3 T C 5: 120,771,056 D275G probably damaging Het
Olfr294 A T 7: 86,615,762 D294E possibly damaging Het
Ovch2 A G 7: 107,785,492 S473P probably damaging Het
Pde8b T A 13: 95,222,767 Y16F probably damaging Het
Pmfbp1 A T 8: 109,520,921 probably null Het
Pmvk T C 3: 89,468,517 V74A probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,153,445 T202S unknown Het
Rheb C T 5: 24,803,723 E166K probably damaging Het
Rnf5 A G 17: 34,603,358 V39A possibly damaging Het
Scn7a T C 2: 66,682,808 Y1168C probably damaging Het
Tas2r114 A G 6: 131,689,648 I139T probably benign Het
Tma7 T C 9: 109,082,206 probably benign Het
Tmem181a T A 17: 6,280,626 S13T possibly damaging Het
Tmem62 C T 2: 120,979,124 probably benign Het
Trim71 T C 9: 114,512,844 D790G probably damaging Het
Trp53tg5 T C 2: 164,471,299 K152R probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Zdbf2 C A 1: 63,304,205 A581E probably damaging Het
Other mutations in Gpr137c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Gpr137c APN 14 45278745 missense probably damaging 0.97
IGL02167:Gpr137c APN 14 45279955 missense probably damaging 0.98
IGL02203:Gpr137c APN 14 45277487 missense possibly damaging 0.86
IGL02960:Gpr137c APN 14 45246433 missense possibly damaging 0.92
R0731:Gpr137c UTSW 14 45246349 missense probably damaging 1.00
R1162:Gpr137c UTSW 14 45244158 missense possibly damaging 0.89
R1245:Gpr137c UTSW 14 45279065 utr 3 prime probably benign
R1983:Gpr137c UTSW 14 45279971 missense probably benign 0.01
R2060:Gpr137c UTSW 14 45244159 missense probably damaging 1.00
R2428:Gpr137c UTSW 14 45278963 missense probably damaging 1.00
R3911:Gpr137c UTSW 14 45278935 missense probably benign 0.31
R4037:Gpr137c UTSW 14 45220230 missense probably damaging 0.99
R4038:Gpr137c UTSW 14 45220230 missense probably damaging 0.99
R4213:Gpr137c UTSW 14 45246508 missense probably damaging 0.99
R4986:Gpr137c UTSW 14 45246286 critical splice acceptor site probably null
R5521:Gpr137c UTSW 14 45278694 missense possibly damaging 0.92
R6028:Gpr137c UTSW 14 45277481 missense probably damaging 0.96
R7117:Gpr137c UTSW 14 45279027 missense probably damaging 1.00
X0027:Gpr137c UTSW 14 45278669 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCTCATGAGGGTATCAGTGTCC -3'
(R):5'- ACAGGAGTGTCTCAGTGTCC -3'

Sequencing Primer
(F):5'- TATCAGTGTCCGGGCCG -3'
(R):5'- AGTGTCTCAGTGTCCCCAGAC -3'
Posted On2015-02-05