Incidental Mutation 'R3034:Apol7a'
ID264799
Institutional Source Beutler Lab
Gene Symbol Apol7a
Ensembl Gene ENSMUSG00000010601
Gene Nameapolipoprotein L 7a
SynonymsApol3, 9130022K13Rik
MMRRC Submission 040550-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R3034 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location77388219-77399110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 77389723 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 180 (I180L)
Ref Sequence ENSEMBL: ENSMUSP00000134864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010745] [ENSMUST00000175789] [ENSMUST00000175919] [ENSMUST00000176074]
Predicted Effect probably benign
Transcript: ENSMUST00000010745
AA Change: I180L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000010745
Gene: ENSMUSG00000010601
AA Change: I180L

DomainStartEndE-ValueType
Pfam:ApoL 20 82 2.4e-13 PFAM
low complexity region 84 95 N/A INTRINSIC
Pfam:ApoL 123 416 1.8e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175789
Predicted Effect probably benign
Transcript: ENSMUST00000175919
AA Change: I180L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135864
Gene: ENSMUSG00000010601
AA Change: I180L

DomainStartEndE-ValueType
Pfam:ApoL 20 416 3.1e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176074
AA Change: I180L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134864
Gene: ENSMUSG00000010601
AA Change: I180L

DomainStartEndE-ValueType
Pfam:ApoL 20 416 3.1e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177135
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,316,253 I576V probably benign Het
Aptx T C 4: 40,694,994 N114S probably benign Het
Cd40 T A 2: 165,062,315 S65R probably benign Het
Cdh23 C T 10: 60,409,010 probably benign Het
Coro7 G A 16: 4,632,291 R565W probably damaging Het
Cpt1a C T 19: 3,378,390 T588M probably damaging Het
Defb23 A G 2: 152,459,269 S128P possibly damaging Het
Dgki G A 6: 37,087,670 H250Y probably damaging Het
Fgr T C 4: 132,998,496 probably null Het
Fkbp15 T C 4: 62,306,892 probably null Het
Gpr137c C T 14: 45,220,276 S95L probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Krt1 C A 15: 101,850,633 R32L unknown Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mrps28 T A 3: 8,923,615 D61V probably benign Het
Mthfd1 A G 12: 76,289,470 K299E probably benign Het
Myo1b A G 1: 51,773,247 Y738H possibly damaging Het
Myo5c A G 9: 75,286,577 T1205A probably benign Het
Nfatc2 C T 2: 168,535,020 G317S probably damaging Het
Nln C T 13: 104,037,439 V525I possibly damaging Het
Nrap T C 19: 56,364,005 E549G probably damaging Het
Nwd2 T A 5: 63,800,103 Y259N probably damaging Het
Oas3 T C 5: 120,771,056 D275G probably damaging Het
Olfr294 A T 7: 86,615,762 D294E possibly damaging Het
Ovch2 A G 7: 107,785,492 S473P probably damaging Het
Pde8b T A 13: 95,222,767 Y16F probably damaging Het
Pmfbp1 A T 8: 109,520,921 probably null Het
Pmvk T C 3: 89,468,517 V74A probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,153,445 T202S unknown Het
Rheb C T 5: 24,803,723 E166K probably damaging Het
Rnf5 A G 17: 34,603,358 V39A possibly damaging Het
Scn7a T C 2: 66,682,808 Y1168C probably damaging Het
Tas2r114 A G 6: 131,689,648 I139T probably benign Het
Tma7 T C 9: 109,082,206 probably benign Het
Tmem181a T A 17: 6,280,626 S13T possibly damaging Het
Tmem62 C T 2: 120,979,124 probably benign Het
Trim71 T C 9: 114,512,844 D790G probably damaging Het
Trp53tg5 T C 2: 164,471,299 K152R probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Zdbf2 C A 1: 63,304,205 A581E probably damaging Het
Other mutations in Apol7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Apol7a APN 15 77389855 unclassified probably benign
IGL01408:Apol7a APN 15 77389330 missense probably damaging 1.00
IGL01702:Apol7a APN 15 77389686 unclassified probably null
IGL02215:Apol7a APN 15 77393490 missense possibly damaging 0.81
IGL02931:Apol7a APN 15 77393450 nonsense probably null
R0610:Apol7a UTSW 15 77389254 missense probably benign 0.06
R0652:Apol7a UTSW 15 77389855 unclassified probably benign
R1616:Apol7a UTSW 15 77389606 missense probably damaging 1.00
R1756:Apol7a UTSW 15 77393471 missense possibly damaging 0.93
R4566:Apol7a UTSW 15 77389751 nonsense probably null
R5059:Apol7a UTSW 15 77389812 unclassified probably benign
R6807:Apol7a UTSW 15 77393320 intron probably null
R6995:Apol7a UTSW 15 77389976 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCTGACAATGCCAGACTGAC -3'
(R):5'- GTGTAGCTGATACTGATGTAGAAGATG -3'

Sequencing Primer
(F):5'- AGACTGACTCCTGCTGTCACAG -3'
(R):5'- TACTGATGTAGAAGATGAAGATGGTG -3'
Posted On2015-02-05