Incidental Mutation 'R3034:Coro7'
ID264801
Institutional Source Beutler Lab
Gene Symbol Coro7
Ensembl Gene ENSMUSG00000039637
Gene Namecoronin 7
Synonyms0610011B16Rik
MMRRC Submission 040550-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3034 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4626133-4679777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4632291 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 565 (R565W)
Ref Sequence ENSEMBL: ENSMUSP00000048489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000135823]
Predicted Effect probably damaging
Transcript: ENSMUST00000038552
AA Change: R565W

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637
AA Change: R565W

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130125
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151156
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal but exhibit disruption of the Golgi apparatus. Mutant fibroblasts show increased cell spreading and cellular F-actin content, increased cell polarization and migration, and enhanced wound healing in a scratch-wound assay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,316,253 I576V probably benign Het
Apol7a T G 15: 77,389,723 I180L probably benign Het
Aptx T C 4: 40,694,994 N114S probably benign Het
Cd40 T A 2: 165,062,315 S65R probably benign Het
Cdh23 C T 10: 60,409,010 probably benign Het
Cpt1a C T 19: 3,378,390 T588M probably damaging Het
Defb23 A G 2: 152,459,269 S128P possibly damaging Het
Dgki G A 6: 37,087,670 H250Y probably damaging Het
Fgr T C 4: 132,998,496 probably null Het
Fkbp15 T C 4: 62,306,892 probably null Het
Gpr137c C T 14: 45,220,276 S95L probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Krt1 C A 15: 101,850,633 R32L unknown Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mrps28 T A 3: 8,923,615 D61V probably benign Het
Mthfd1 A G 12: 76,289,470 K299E probably benign Het
Myo1b A G 1: 51,773,247 Y738H possibly damaging Het
Myo5c A G 9: 75,286,577 T1205A probably benign Het
Nfatc2 C T 2: 168,535,020 G317S probably damaging Het
Nln C T 13: 104,037,439 V525I possibly damaging Het
Nrap T C 19: 56,364,005 E549G probably damaging Het
Nwd2 T A 5: 63,800,103 Y259N probably damaging Het
Oas3 T C 5: 120,771,056 D275G probably damaging Het
Olfr294 A T 7: 86,615,762 D294E possibly damaging Het
Ovch2 A G 7: 107,785,492 S473P probably damaging Het
Pde8b T A 13: 95,222,767 Y16F probably damaging Het
Pmfbp1 A T 8: 109,520,921 probably null Het
Pmvk T C 3: 89,468,517 V74A probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,153,445 T202S unknown Het
Rheb C T 5: 24,803,723 E166K probably damaging Het
Rnf5 A G 17: 34,603,358 V39A possibly damaging Het
Scn7a T C 2: 66,682,808 Y1168C probably damaging Het
Tas2r114 A G 6: 131,689,648 I139T probably benign Het
Tma7 T C 9: 109,082,206 probably benign Het
Tmem181a T A 17: 6,280,626 S13T possibly damaging Het
Tmem62 C T 2: 120,979,124 probably benign Het
Trim71 T C 9: 114,512,844 D790G probably damaging Het
Trp53tg5 T C 2: 164,471,299 K152R probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Zdbf2 C A 1: 63,304,205 A581E probably damaging Het
Other mutations in Coro7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Coro7 APN 16 4634636 missense possibly damaging 0.83
IGL00885:Coro7 APN 16 4635026 missense probably benign 0.00
IGL02944:Coro7 APN 16 4635412 missense probably benign 0.14
IGL03104:Coro7 APN 16 4629126 missense probably damaging 1.00
IGL03153:Coro7 APN 16 4635382 critical splice donor site probably null
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0080:Coro7 UTSW 16 4630464 missense probably damaging 1.00
R0193:Coro7 UTSW 16 4627504 unclassified probably benign
R0242:Coro7 UTSW 16 4630178 splice site probably benign
R0318:Coro7 UTSW 16 4675807 missense probably benign 0.09
R0554:Coro7 UTSW 16 4632257 missense possibly damaging 0.63
R0666:Coro7 UTSW 16 4631911 missense possibly damaging 0.70
R0835:Coro7 UTSW 16 4632254 missense probably benign 0.12
R0968:Coro7 UTSW 16 4670055 splice site probably benign
R1670:Coro7 UTSW 16 4628233 missense possibly damaging 0.76
R1709:Coro7 UTSW 16 4634441 splice site probably null
R1848:Coro7 UTSW 16 4630434 missense probably damaging 0.99
R1884:Coro7 UTSW 16 4628819 unclassified probably benign
R1935:Coro7 UTSW 16 4628732 missense probably benign
R1937:Coro7 UTSW 16 4628732 missense probably benign
R1939:Coro7 UTSW 16 4628732 missense probably benign
R1967:Coro7 UTSW 16 4634889 missense probably damaging 1.00
R1969:Coro7 UTSW 16 4633756 missense probably benign 0.19
R1970:Coro7 UTSW 16 4633756 missense probably benign 0.19
R4638:Coro7 UTSW 16 4632287 missense probably damaging 0.96
R4710:Coro7 UTSW 16 4634933 intron probably benign
R4723:Coro7 UTSW 16 4631994 missense probably benign 0.00
R4789:Coro7 UTSW 16 4628221 missense probably damaging 1.00
R5493:Coro7 UTSW 16 4632487 missense probably damaging 0.99
R5619:Coro7 UTSW 16 4676935 critical splice donor site probably null
R5756:Coro7 UTSW 16 4632284 missense probably damaging 0.97
R5974:Coro7 UTSW 16 4631889 missense possibly damaging 0.83
R6010:Coro7 UTSW 16 4669956 missense possibly damaging 0.68
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6906:Coro7 UTSW 16 4633304 missense probably benign 0.00
R6925:Coro7 UTSW 16 4628674 critical splice donor site probably null
R7069:Coro7 UTSW 16 4679611 start codon destroyed probably damaging 0.99
R7326:Coro7 UTSW 16 4632048 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAAGCGCAGAGAGTAGATCTTTTC -3'
(R):5'- GACACAGCATTGCCTACACTTC -3'

Sequencing Primer
(F):5'- CAGAGAGTAGATCTTTTCTGTGTGGC -3'
(R):5'- TGCCTACACTTCAGAATGGG -3'
Posted On2015-02-05