Incidental Mutation 'R3034:Nrap'
ID264806
Institutional Source Beutler Lab
Gene Symbol Nrap
Ensembl Gene ENSMUSG00000049134
Gene Namenebulin-related anchoring protein
Synonyms
MMRRC Submission 040550-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R3034 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56320035-56390037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56364005 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 549 (E549G)
Ref Sequence ENSEMBL: ENSMUSP00000132582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040711] [ENSMUST00000073536] [ENSMUST00000095947] [ENSMUST00000166203] [ENSMUST00000167239]
Predicted Effect probably damaging
Transcript: ENSMUST00000040711
AA Change: E550G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048364
Gene: ENSMUSG00000049134
AA Change: E550G

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 1.76e-2 SMART
NEBU 1418 1448 2.09e0 SMART
NEBU 1453 1483 6.4e-5 SMART
NEBU 1489 1519 8.63e-1 SMART
NEBU 1527 1557 1.33e-2 SMART
NEBU 1562 1592 1.84e-5 SMART
NEBU 1593 1623 7.24e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073536
AA Change: E585G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073228
Gene: ENSMUSG00000049134
AA Change: E585G

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.73e-10 SMART
NEBU 556 586 8.12e-7 SMART
NEBU 590 620 1.73e-1 SMART
NEBU 625 655 2.33e-7 SMART
NEBU 656 686 1.49e-5 SMART
NEBU 690 721 5.12e-4 SMART
NEBU 724 754 8.12e-7 SMART
NEBU 759 789 2.64e-6 SMART
NEBU 795 825 3.48e-6 SMART
NEBU 833 863 2.35e-3 SMART
NEBU 868 898 6.11e-2 SMART
NEBU 899 929 1.69e-4 SMART
NEBU 934 964 3.88e-4 SMART
NEBU 967 997 4e-6 SMART
NEBU 1002 1032 4.22e-5 SMART
NEBU 1038 1068 2.64e-6 SMART
NEBU 1076 1106 3.68e-5 SMART
NEBU 1111 1141 4.16e-4 SMART
NEBU 1142 1172 1.1e-3 SMART
NEBU 1177 1207 1.68e1 SMART
NEBU 1210 1240 4.59e-6 SMART
NEBU 1245 1275 4.06e-7 SMART
NEBU 1281 1311 1.99e-1 SMART
NEBU 1319 1349 1.85e-1 SMART
NEBU 1354 1384 1.39e-5 SMART
NEBU 1385 1415 4.03e-2 SMART
NEBU 1420 1450 1.76e-2 SMART
NEBU 1453 1483 2.09e0 SMART
NEBU 1488 1518 6.4e-5 SMART
NEBU 1524 1554 8.63e-1 SMART
NEBU 1562 1592 1.33e-2 SMART
NEBU 1597 1627 1.84e-5 SMART
NEBU 1628 1658 7.24e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095947
AA Change: E468G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093640
Gene: ENSMUSG00000049134
AA Change: E468G

DomainStartEndE-ValueType
NEBU 86 115 1.2e-6 SMART
NEBU 120 150 9.1e-8 SMART
NEBU 157 186 1.4e-6 SMART
NEBU 226 255 1.8e-8 SMART
NEBU 264 294 2.5e-5 SMART
NEBU 300 330 7.8e-6 SMART
NEBU 368 398 6e-11 SMART
NEBU 403 433 1.1e-12 SMART
NEBU 439 469 5.2e-9 SMART
NEBU 473 503 1.1e-3 SMART
NEBU 508 538 1.5e-9 SMART
NEBU 539 569 1e-7 SMART
NEBU 573 604 3.3e-6 SMART
NEBU 607 637 5.4e-9 SMART
NEBU 642 672 1.7e-8 SMART
NEBU 678 708 2.3e-8 SMART
NEBU 716 746 1.5e-5 SMART
NEBU 751 781 4.1e-4 SMART
NEBU 782 812 1.1e-6 SMART
NEBU 817 847 2.6e-6 SMART
NEBU 850 880 2.6e-8 SMART
NEBU 885 915 2.7e-7 SMART
NEBU 921 951 1.7e-8 SMART
NEBU 959 989 2.4e-7 SMART
NEBU 994 1024 2.7e-6 SMART
NEBU 1025 1055 7.2e-6 SMART
NEBU 1060 1090 1.1e-1 SMART
NEBU 1093 1123 3e-8 SMART
NEBU 1128 1158 2.6e-9 SMART
NEBU 1164 1194 1.3e-3 SMART
NEBU 1202 1232 1.2e-3 SMART
NEBU 1237 1267 8.8e-8 SMART
NEBU 1268 1298 2.7e-4 SMART
NEBU 1303 1333 1.2e-4 SMART
NEBU 1336 1366 1.4e-2 SMART
NEBU 1371 1401 4.3e-7 SMART
NEBU 1407 1437 5.6e-3 SMART
NEBU 1445 1475 8.8e-5 SMART
NEBU 1480 1510 1.2e-7 SMART
NEBU 1511 1541 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163160
Predicted Effect probably damaging
Transcript: ENSMUST00000166203
AA Change: E549G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132582
Gene: ENSMUSG00000049134
AA Change: E549G

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.06e-10 SMART
NEBU 554 584 1.73e-1 SMART
NEBU 589 619 2.33e-7 SMART
NEBU 620 650 1.49e-5 SMART
NEBU 654 685 5.12e-4 SMART
NEBU 688 718 8.12e-7 SMART
NEBU 723 753 2.64e-6 SMART
NEBU 759 789 3.48e-6 SMART
NEBU 797 827 2.35e-3 SMART
NEBU 832 862 6.11e-2 SMART
NEBU 863 893 1.69e-4 SMART
NEBU 898 928 3.88e-4 SMART
NEBU 931 961 4e-6 SMART
NEBU 966 996 4.22e-5 SMART
NEBU 1002 1032 2.64e-6 SMART
NEBU 1040 1070 3.68e-5 SMART
NEBU 1075 1105 4.16e-4 SMART
NEBU 1106 1136 1.1e-3 SMART
NEBU 1141 1171 1.68e1 SMART
NEBU 1174 1204 4.59e-6 SMART
NEBU 1209 1239 4.06e-7 SMART
NEBU 1245 1275 1.99e-1 SMART
NEBU 1283 1313 1.85e-1 SMART
NEBU 1318 1348 1.39e-5 SMART
NEBU 1349 1379 4.03e-2 SMART
NEBU 1384 1414 1.76e-2 SMART
NEBU 1417 1447 2.09e0 SMART
NEBU 1452 1482 6.4e-5 SMART
NEBU 1488 1518 8.63e-1 SMART
NEBU 1526 1556 1.33e-2 SMART
NEBU 1561 1591 1.84e-5 SMART
NEBU 1592 1622 7.24e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167239
AA Change: E550G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128196
Gene: ENSMUSG00000049134
AA Change: E550G

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 3.06e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000169099
AA Change: E308G
SMART Domains Protein: ENSMUSP00000125889
Gene: ENSMUSG00000049134
AA Change: E308G

DomainStartEndE-ValueType
NEBU 32 61 2.83e-6 SMART
NEBU 70 100 7.24e-4 SMART
NEBU 105 135 3.46e-1 SMART
NEBU 141 171 1.18e-3 SMART
NEBU 209 239 8.97e-9 SMART
NEBU 244 274 1.73e-10 SMART
NEBU 280 310 8.12e-7 SMART
NEBU 314 344 1.73e-1 SMART
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,316,253 I576V probably benign Het
Apol7a T G 15: 77,389,723 I180L probably benign Het
Aptx T C 4: 40,694,994 N114S probably benign Het
Cd40 T A 2: 165,062,315 S65R probably benign Het
Cdh23 C T 10: 60,409,010 probably benign Het
Coro7 G A 16: 4,632,291 R565W probably damaging Het
Cpt1a C T 19: 3,378,390 T588M probably damaging Het
Defb23 A G 2: 152,459,269 S128P possibly damaging Het
Dgki G A 6: 37,087,670 H250Y probably damaging Het
Fgr T C 4: 132,998,496 probably null Het
Fkbp15 T C 4: 62,306,892 probably null Het
Gpr137c C T 14: 45,220,276 S95L probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Krt1 C A 15: 101,850,633 R32L unknown Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mrps28 T A 3: 8,923,615 D61V probably benign Het
Mthfd1 A G 12: 76,289,470 K299E probably benign Het
Myo1b A G 1: 51,773,247 Y738H possibly damaging Het
Myo5c A G 9: 75,286,577 T1205A probably benign Het
Nfatc2 C T 2: 168,535,020 G317S probably damaging Het
Nln C T 13: 104,037,439 V525I possibly damaging Het
Nwd2 T A 5: 63,800,103 Y259N probably damaging Het
Oas3 T C 5: 120,771,056 D275G probably damaging Het
Olfr294 A T 7: 86,615,762 D294E possibly damaging Het
Ovch2 A G 7: 107,785,492 S473P probably damaging Het
Pde8b T A 13: 95,222,767 Y16F probably damaging Het
Pmfbp1 A T 8: 109,520,921 probably null Het
Pmvk T C 3: 89,468,517 V74A probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rbm26 T A 14: 105,153,445 T202S unknown Het
Rheb C T 5: 24,803,723 E166K probably damaging Het
Rnf5 A G 17: 34,603,358 V39A possibly damaging Het
Scn7a T C 2: 66,682,808 Y1168C probably damaging Het
Tas2r114 A G 6: 131,689,648 I139T probably benign Het
Tma7 T C 9: 109,082,206 probably benign Het
Tmem181a T A 17: 6,280,626 S13T possibly damaging Het
Tmem62 C T 2: 120,979,124 probably benign Het
Trim71 T C 9: 114,512,844 D790G probably damaging Het
Trp53tg5 T C 2: 164,471,299 K152R probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Zdbf2 C A 1: 63,304,205 A581E probably damaging Het
Other mutations in Nrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Nrap APN 19 56372909 missense probably damaging 1.00
IGL00570:Nrap APN 19 56338113 missense probably benign 0.10
IGL00946:Nrap APN 19 56340626 splice site probably null
IGL01070:Nrap APN 19 56329084 missense probably damaging 1.00
IGL01111:Nrap APN 19 56345558 missense probably damaging 1.00
IGL01138:Nrap APN 19 56355538 missense probably damaging 1.00
IGL01290:Nrap APN 19 56361748 missense probably damaging 1.00
IGL01352:Nrap APN 19 56379836 missense probably benign 0.00
IGL01372:Nrap APN 19 56329102 critical splice acceptor site probably null
IGL01395:Nrap APN 19 56361793 missense probably damaging 1.00
IGL01413:Nrap APN 19 56389391 missense probably damaging 0.99
IGL01734:Nrap APN 19 56350309 missense probably damaging 1.00
IGL01933:Nrap APN 19 56388818 missense probably damaging 1.00
IGL02156:Nrap APN 19 56321000 missense probably damaging 1.00
IGL02415:Nrap APN 19 56382309 missense probably damaging 1.00
IGL02447:Nrap APN 19 56345519 nonsense probably null
IGL02864:Nrap APN 19 56350374 missense probably damaging 1.00
IGL02993:Nrap APN 19 56345533 missense probably damaging 1.00
IGL03003:Nrap APN 19 56321952 missense probably damaging 1.00
IGL03006:Nrap APN 19 56347164 missense probably benign 0.02
IGL03084:Nrap APN 19 56365454 missense probably damaging 1.00
IGL03136:Nrap APN 19 56342255 missense possibly damaging 0.69
IGL03272:Nrap APN 19 56345568 intron probably benign
IGL03389:Nrap APN 19 56351716 missense probably benign 0.10
R0116:Nrap UTSW 19 56355546 missense probably damaging 1.00
R0374:Nrap UTSW 19 56351622 missense probably damaging 1.00
R0715:Nrap UTSW 19 56357325 missense probably damaging 0.98
R0828:Nrap UTSW 19 56345558 missense probably damaging 1.00
R0883:Nrap UTSW 19 56345474 missense probably damaging 1.00
R1416:Nrap UTSW 19 56327293 missense possibly damaging 0.60
R1459:Nrap UTSW 19 56384130 missense probably benign 0.00
R1616:Nrap UTSW 19 56389823 missense probably damaging 1.00
R1676:Nrap UTSW 19 56335255 missense probably damaging 1.00
R1687:Nrap UTSW 19 56355529 missense probably damaging 0.99
R1766:Nrap UTSW 19 56335042 missense probably damaging 0.99
R1792:Nrap UTSW 19 56379158 missense probably benign 0.00
R1817:Nrap UTSW 19 56384055 unclassified probably benign
R1972:Nrap UTSW 19 56357353 missense probably damaging 1.00
R1982:Nrap UTSW 19 56384105 missense probably damaging 0.99
R2258:Nrap UTSW 19 56321962 missense possibly damaging 0.80
R2448:Nrap UTSW 19 56322030 missense possibly damaging 0.90
R3801:Nrap UTSW 19 56321779 missense probably damaging 1.00
R3804:Nrap UTSW 19 56321779 missense probably damaging 1.00
R3923:Nrap UTSW 19 56380256 missense probably damaging 0.99
R3964:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3965:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3966:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3980:Nrap UTSW 19 56381552 missense probably benign 0.01
R4182:Nrap UTSW 19 56350327 missense probably damaging 1.00
R4499:Nrap UTSW 19 56351481 missense probably damaging 0.97
R4573:Nrap UTSW 19 56342338 critical splice acceptor site probably null
R4603:Nrap UTSW 19 56335024 critical splice donor site probably null
R4689:Nrap UTSW 19 56386026 missense probably damaging 0.97
R4749:Nrap UTSW 19 56380237 missense probably damaging 0.96
R4845:Nrap UTSW 19 56351470 missense probably benign 0.16
R4937:Nrap UTSW 19 56347220 missense probably damaging 1.00
R4962:Nrap UTSW 19 56378143 missense probably damaging 1.00
R5156:Nrap UTSW 19 56371845 missense possibly damaging 0.94
R5181:Nrap UTSW 19 56345528 missense possibly damaging 0.85
R5202:Nrap UTSW 19 56335151 missense probably damaging 1.00
R5262:Nrap UTSW 19 56320223 missense possibly damaging 0.95
R5301:Nrap UTSW 19 56379109 missense probably damaging 1.00
R5380:Nrap UTSW 19 56381603 missense probably damaging 1.00
R5576:Nrap UTSW 19 56321982 missense probably damaging 0.99
R5631:Nrap UTSW 19 56354121 missense probably benign 0.19
R5754:Nrap UTSW 19 56389484 missense possibly damaging 0.55
R5799:Nrap UTSW 19 56342169 nonsense probably null
R5899:Nrap UTSW 19 56340574 missense possibly damaging 0.80
R5910:Nrap UTSW 19 56342311 missense probably benign 0.00
R5994:Nrap UTSW 19 56351599 nonsense probably null
R6124:Nrap UTSW 19 56386026 missense probably damaging 0.97
R6149:Nrap UTSW 19 56389453 missense possibly damaging 0.79
R6182:Nrap UTSW 19 56361698 missense probably benign
R6245:Nrap UTSW 19 56354221 missense probably damaging 1.00
R6245:Nrap UTSW 19 56379875 missense possibly damaging 0.80
R6270:Nrap UTSW 19 56320198 missense probably benign 0.00
R6274:Nrap UTSW 19 56361721 missense probably benign 0.21
R6340:Nrap UTSW 19 56347184 missense probably damaging 1.00
R6547:Nrap UTSW 19 56351566 missense probably benign 0.00
R6734:Nrap UTSW 19 56345509 missense probably damaging 0.99
R6770:Nrap UTSW 19 56382537 intron probably null
R6812:Nrap UTSW 19 56351676 missense probably damaging 1.00
R6843:Nrap UTSW 19 56380219 missense probably damaging 1.00
X0028:Nrap UTSW 19 56335220 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCTTGCAGGTGGAAGTC -3'
(R):5'- ACCTGCTGGAGAAATAATGACTG -3'

Sequencing Primer
(F):5'- TCTGCAGAAAGGCAAGCTTG -3'
(R):5'- CTGCTGGAGAAATAATGACTGTTAAC -3'
Posted On2015-02-05