Incidental Mutation 'R3035:Apba2'
ID264818
Institutional Source Beutler Lab
Gene Symbol Apba2
Ensembl Gene ENSMUSG00000030519
Gene Nameamyloid beta (A4) precursor protein-binding, family A, member 2
SynonymsX11L, X11-like, Mint 2
MMRRC Submission 040551-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R3035 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location64501706-64753878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64739792 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 479 (S479P)
Ref Sequence ENSEMBL: ENSMUSP00000032732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032732] [ENSMUST00000206246]
Predicted Effect probably benign
Transcript: ENSMUST00000032732
AA Change: S479P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032732
Gene: ENSMUSG00000030519
AA Change: S479P

DomainStartEndE-ValueType
low complexity region 82 96 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
PTB 368 534 6.31e-29 SMART
PDZ 578 656 6.32e-12 SMART
PDZ 670 736 1.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107507
AA Change: S467P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103131
Gene: ENSMUSG00000030519
AA Change: S467P

DomainStartEndE-ValueType
low complexity region 82 96 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
PTB 368 522 8.46e-30 SMART
PDZ 566 644 6.32e-12 SMART
PDZ 658 724 1.79e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206061
Predicted Effect probably benign
Transcript: ENSMUST00000206246
AA Change: S467P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000206630
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show a selective deficit in motivated approach behavior, but not in motivated avoidance behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,745,418 V687D probably benign Het
Ahctf1 T A 1: 179,753,870 Q1589L probably damaging Het
C1galt1 A G 6: 7,866,762 K203E probably benign Het
Dennd5a A G 7: 109,921,352 S433P probably benign Het
Dock9 A G 14: 121,606,837 S1181P possibly damaging Het
Gsc2 A G 16: 17,914,928 S26P probably damaging Het
Hcn4 T C 9: 58,823,680 S57P unknown Het
Herc1 C A 9: 66,483,935 Q4007K possibly damaging Het
Ighv1-54 C A 12: 115,193,977 V17F probably damaging Het
Kctd12 T A 14: 102,981,506 E312V possibly damaging Het
Kdf1 A G 4: 133,528,062 N30S probably benign Het
Kif11 T A 19: 37,407,053 S587T possibly damaging Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mgam A G 6: 40,663,530 I511V probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Serpinb9b T A 13: 33,029,546 C29S possibly damaging Het
Slc12a5 C A 2: 164,980,258 L343I probably benign Het
Topors C T 4: 40,269,673 probably null Het
Other mutations in Apba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Apba2 APN 7 64736941 missense possibly damaging 0.79
IGL01716:Apba2 APN 7 64745826 splice site probably benign
IGL02218:Apba2 APN 7 64695677 missense probably benign 0.01
IGL02343:Apba2 APN 7 64695146 missense probably damaging 0.96
IGL03265:Apba2 APN 7 64695323 missense probably damaging 1.00
guadalupe UTSW 7 64750164 missense probably damaging 1.00
LCD18:Apba2 UTSW 7 64622160 intron probably benign
R0395:Apba2 UTSW 7 64743408 missense probably benign 0.00
R0554:Apba2 UTSW 7 64745780 missense probably damaging 1.00
R0624:Apba2 UTSW 7 64714515 splice site probably null
R0733:Apba2 UTSW 7 64750164 missense probably damaging 1.00
R1107:Apba2 UTSW 7 64745719 missense possibly damaging 0.51
R1464:Apba2 UTSW 7 64695549 missense probably benign
R1464:Apba2 UTSW 7 64695549 missense probably benign
R1486:Apba2 UTSW 7 64736948 missense probably damaging 1.00
R1895:Apba2 UTSW 7 64744630 critical splice donor site probably null
R1942:Apba2 UTSW 7 64695470 missense possibly damaging 0.92
R1946:Apba2 UTSW 7 64744630 critical splice donor site probably null
R2002:Apba2 UTSW 7 64733542 missense probably damaging 0.97
R2089:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2091:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2091:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2571:Apba2 UTSW 7 64745750 missense probably damaging 0.98
R4620:Apba2 UTSW 7 64714467 missense probably damaging 1.00
R5468:Apba2 UTSW 7 64745762 missense probably damaging 1.00
R5478:Apba2 UTSW 7 64695186 nonsense probably null
R5644:Apba2 UTSW 7 64715511 missense probably benign
R5645:Apba2 UTSW 7 64695806 missense possibly damaging 0.92
R5941:Apba2 UTSW 7 64745716 missense probably benign 0.03
R5969:Apba2 UTSW 7 64744447 nonsense probably null
R6190:Apba2 UTSW 7 64739880 missense probably damaging 0.98
R6806:Apba2 UTSW 7 64695459 missense probably damaging 1.00
R7098:Apba2 UTSW 7 64736948 missense probably damaging 1.00
R7143:Apba2 UTSW 7 64744417 missense probably damaging 1.00
R7183:Apba2 UTSW 7 64733545 missense probably benign 0.11
R7260:Apba2 UTSW 7 64739745 missense probably damaging 1.00
R7479:Apba2 UTSW 7 64739859 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGATTTTCTCAGCAAGGGCC -3'
(R):5'- TGCAAGTGTGGACTGAGAC -3'

Sequencing Primer
(F):5'- GCAAGGGCCACTTAATTAATGTCC -3'
(R):5'- TGGACTGAGACACTTGTTCC -3'
Posted On2015-02-05