Incidental Mutation 'R3040:Ccar1'
ID264924
Institutional Source Beutler Lab
Gene Symbol Ccar1
Ensembl Gene ENSMUSG00000020074
Gene Namecell division cycle and apoptosis regulator 1
Synonyms9430036H15Rik, Carp1, 2610511G16Rik
MMRRC Submission 040556-MU
Accession Numbers

Genbank: NM_026201.3; Ensembl: ENSMUST00000020268

Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R3040 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62743928-62792286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 62756494 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 760 (H760N)
Ref Sequence ENSEMBL: ENSMUSP00000151895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020268] [ENSMUST00000219527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020268
AA Change: H760N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020268
Gene: ENSMUSG00000020074
AA Change: H760N

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 62 106 N/A INTRINSIC
Pfam:S1-like 144 201 1.7e-34 PFAM
low complexity region 236 254 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 358 N/A INTRINSIC
DBC1 475 606 4.46e-90 SMART
SAP 633 667 5.25e-9 SMART
Blast:HDc 753 784 1e-7 BLAST
coiled coil region 792 819 N/A INTRINSIC
low complexity region 871 895 N/A INTRINSIC
SCOP:d1hqva_ 898 964 5e-3 SMART
Blast:HDc 921 979 5e-17 BLAST
coiled coil region 1029 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218786
Predicted Effect possibly damaging
Transcript: ENSMUST00000219527
AA Change: H760N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220236
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(45) : Targeted, other(4) Gene trapped(41)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 A C 9: 14,572,773 V498G probably benign Het
Ampd2 A G 3: 108,076,416 Y602H probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cyp2c50 A G 19: 40,098,126 N319S probably benign Het
Dcdc2c G C 12: 28,552,182 A41G probably damaging Het
Dzip3 G A 16: 48,928,324 S1083F probably damaging Het
Etfdh C T 3: 79,604,919 R498Q probably damaging Het
Fam198b T A 3: 79,887,125 I300N possibly damaging Het
Fbn2 A T 18: 58,093,387 C772S probably damaging Het
Gdap2 T C 3: 100,188,035 probably null Het
Gm10436 A T 12: 88,178,348 S69R probably benign Het
Iqcj T C 3: 68,055,342 S79P probably damaging Het
Isg20l2 T C 3: 87,931,995 V171A probably benign Het
Kcna7 GGCTGCGCGGTGCCGCCCGAGCGGCCGCTGC GGCTGC 7: 45,406,788 probably null Het
Luc7l A T 17: 26,277,619 probably benign Het
Mepe T G 5: 104,338,122 L376R probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nedd4 T C 9: 72,669,961 F23L probably benign Het
Neurl1a T C 19: 47,239,831 S22P probably benign Het
Psmd2 T C 16: 20,657,567 V470A probably benign Het
Pyroxd2 G T 19: 42,735,518 Q323K probably benign Het
Slf2 A G 19: 44,980,569 D1157G probably damaging Het
Styxl1 C T 5: 135,757,033 A197T probably damaging Het
Tmem70 C T 1: 16,667,765 T100M possibly damaging Het
Trip12 A G 1: 84,742,245 V309A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn1r122 G C 7: 21,133,446 P228R probably benign Het
Other mutations in Ccar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Ccar1 APN 10 62753234 missense unknown
IGL01291:Ccar1 APN 10 62756649 missense probably damaging 1.00
IGL01364:Ccar1 APN 10 62776874 unclassified probably null
IGL01777:Ccar1 APN 10 62780577 missense possibly damaging 0.71
IGL01958:Ccar1 APN 10 62790935 missense possibly damaging 0.94
IGL03096:Ccar1 APN 10 62764333 missense probably benign 0.20
Lonk UTSW 10 62764533 missense probably damaging 1.00
1mM(1):Ccar1 UTSW 10 62783886 missense probably benign 0.00
ANU05:Ccar1 UTSW 10 62756649 missense probably damaging 1.00
R0440:Ccar1 UTSW 10 62780457 missense possibly damaging 0.94
R1295:Ccar1 UTSW 10 62783882 critical splice donor site probably null
R1573:Ccar1 UTSW 10 62750655 missense unknown
R1585:Ccar1 UTSW 10 62751001 missense unknown
R1633:Ccar1 UTSW 10 62751014 missense unknown
R1840:Ccar1 UTSW 10 62763510 missense probably damaging 0.98
R1854:Ccar1 UTSW 10 62764517 missense probably damaging 1.00
R1905:Ccar1 UTSW 10 62776658 missense possibly damaging 0.85
R2011:Ccar1 UTSW 10 62776694 missense probably benign 0.03
R2041:Ccar1 UTSW 10 62766048 missense probably damaging 1.00
R2202:Ccar1 UTSW 10 62745287 missense unknown
R2327:Ccar1 UTSW 10 62764382 missense probably damaging 1.00
R2932:Ccar1 UTSW 10 62776759 missense probably benign 0.08
R4647:Ccar1 UTSW 10 62747417 nonsense probably null
R4829:Ccar1 UTSW 10 62745335 missense unknown
R4887:Ccar1 UTSW 10 62753218 missense unknown
R4888:Ccar1 UTSW 10 62753218 missense unknown
R5000:Ccar1 UTSW 10 62751005 missense unknown
R5207:Ccar1 UTSW 10 62753281 missense unknown
R5214:Ccar1 UTSW 10 62770961 missense probably damaging 1.00
R5644:Ccar1 UTSW 10 62771978 missense probably benign 0.16
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6035:Ccar1 UTSW 10 62751785 missense unknown
R6063:Ccar1 UTSW 10 62776717 missense possibly damaging 0.70
R6330:Ccar1 UTSW 10 62764533 missense probably damaging 1.00
R6370:Ccar1 UTSW 10 62764529 missense probably damaging 1.00
R6828:Ccar1 UTSW 10 62764430 missense probably damaging 0.98
R6943:Ccar1 UTSW 10 62746936 missense unknown
V8831:Ccar1 UTSW 10 62747406 missense unknown
X0017:Ccar1 UTSW 10 62765340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGTCAGCAAAAGCTACT -3'
(R):5'- TTTCAAATGCCTAGGAAGAAGAAAG -3'

Sequencing Primer
(F):5'- TCAGCAAAAGCTACTAGAGATAGAC -3'
(R):5'- TGCCTAGGAAGAAGAAAGAAAACGTC -3'
Posted On2015-02-05