Incidental Mutation 'R3040:Neurl1a'
ID264936
Institutional Source Beutler Lab
Gene Symbol Neurl1a
Ensembl Gene ENSMUSG00000006435
Gene Nameneuralized E3 ubiquitin protein ligase 1A
SynonymsNeur1, Rnf67, Neurl, Neu1, Nlz, 2410129E16Rik
MMRRC Submission 040556-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R3040 (G1)
Quality Score118
Status Not validated
Chromosome19
Chromosomal Location47178820-47259440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47239831 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 22 (S22P)
Ref Sequence ENSEMBL: ENSMUSP00000107438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111807] [ENSMUST00000111808]
Predicted Effect probably benign
Transcript: ENSMUST00000111807
AA Change: S22P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107438
Gene: ENSMUSG00000006435
AA Change: S22P

DomainStartEndE-ValueType
NEUZ 43 166 8.33e-66 SMART
Blast:NEUZ 186 213 1e-8 BLAST
low complexity region 241 253 N/A INTRINSIC
NEUZ 274 397 1.79e-56 SMART
low complexity region 440 456 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
RING 504 543 2.22e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111808
AA Change: S39P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107439
Gene: ENSMUSG00000006435
AA Change: S39P

DomainStartEndE-ValueType
NEUZ 60 183 8.33e-66 SMART
Blast:NEUZ 203 230 9e-9 BLAST
low complexity region 258 270 N/A INTRINSIC
NEUZ 291 414 1.79e-56 SMART
low complexity region 457 473 N/A INTRINSIC
low complexity region 486 499 N/A INTRINSIC
RING 521 560 2.22e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Depending on the targeted mutation, homozygotes show a spectrum of conflicting phenotypes ranging from axonemal and spermatid abnormalities, male sterility and deficient lactation, to just a specific olfactory discrimination defect and ethanol hypersensitivity on motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 A C 9: 14,572,773 V498G probably benign Het
Ampd2 A G 3: 108,076,416 Y602H probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Ccar1 G T 10: 62,756,494 H760N possibly damaging Het
Cyp2c50 A G 19: 40,098,126 N319S probably benign Het
Dcdc2c G C 12: 28,552,182 A41G probably damaging Het
Dzip3 G A 16: 48,928,324 S1083F probably damaging Het
Etfdh C T 3: 79,604,919 R498Q probably damaging Het
Fam198b T A 3: 79,887,125 I300N possibly damaging Het
Fbn2 A T 18: 58,093,387 C772S probably damaging Het
Gdap2 T C 3: 100,188,035 probably null Het
Gm10436 A T 12: 88,178,348 S69R probably benign Het
Iqcj T C 3: 68,055,342 S79P probably damaging Het
Isg20l2 T C 3: 87,931,995 V171A probably benign Het
Kcna7 GGCTGCGCGGTGCCGCCCGAGCGGCCGCTGC GGCTGC 7: 45,406,788 probably null Het
Luc7l A T 17: 26,277,619 probably benign Het
Mepe T G 5: 104,338,122 L376R probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nedd4 T C 9: 72,669,961 F23L probably benign Het
Psmd2 T C 16: 20,657,567 V470A probably benign Het
Pyroxd2 G T 19: 42,735,518 Q323K probably benign Het
Slf2 A G 19: 44,980,569 D1157G probably damaging Het
Styxl1 C T 5: 135,757,033 A197T probably damaging Het
Tmem70 C T 1: 16,667,765 T100M possibly damaging Het
Trip12 A G 1: 84,742,245 V309A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn1r122 G C 7: 21,133,446 P228R probably benign Het
Other mutations in Neurl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03186:Neurl1a APN 19 47240477 missense probably damaging 0.99
R1403:Neurl1a UTSW 19 47253711 missense probably damaging 1.00
R1822:Neurl1a UTSW 19 47257459 missense probably benign 0.16
R3435:Neurl1a UTSW 19 47257525 missense probably damaging 1.00
R3767:Neurl1a UTSW 19 47239889 missense probably damaging 1.00
R3770:Neurl1a UTSW 19 47239889 missense probably damaging 1.00
R3884:Neurl1a UTSW 19 47253446 missense probably benign 0.30
R4539:Neurl1a UTSW 19 47256744 missense probably damaging 1.00
R5108:Neurl1a UTSW 19 47257635 missense probably damaging 1.00
R5644:Neurl1a UTSW 19 47179477 missense probably benign
R6167:Neurl1a UTSW 19 47239928 missense probably damaging 1.00
R7353:Neurl1a UTSW 19 47240660 missense probably damaging 1.00
X0063:Neurl1a UTSW 19 47253674 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCTGGGAGTGACAGCAAATG -3'
(R):5'- GGTGATGGCATTGCAAAAGC -3'

Sequencing Primer
(F):5'- TGATAACATCACCTCCGAGGGG -3'
(R):5'- ATTGCAAAAGCTGGCCTGC -3'
Posted On2015-02-05