Incidental Mutation 'R3051:Ddr2'
ID 264937
Institutional Source Beutler Lab
Gene Symbol Ddr2
Ensembl Gene ENSMUSG00000026674
Gene Name discoidin domain receptor family, member 2
Synonyms Ntrkr3
MMRRC Submission 040560-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3051 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 169799876-169938331 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 169816024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 561 (K561R)
Ref Sequence ENSEMBL: ENSMUSP00000141443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027985] [ENSMUST00000170800] [ENSMUST00000194690]
AlphaFold Q62371
Predicted Effect probably benign
Transcript: ENSMUST00000027985
AA Change: K561R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027985
Gene: ENSMUSG00000026674
AA Change: K561R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170800
AA Change: K561R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129624
Gene: ENSMUSG00000026674
AA Change: K561R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194690
AA Change: K561R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141443
Gene: ENSMUSG00000026674
AA Change: K561R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
FA58C 29 185 2.39e-43 SMART
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
TyrKc 563 848 1.08e-133 SMART
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, reduced chondrocyte proliferation, shortened long bones and snout, and skull anomalies. Homozygotes for another null allele show similar skeletal defects, small hearts, short cardiomyocytes, lower cardiac collagen density, and altered cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,974,374 (GRCm39) V330I probably benign Het
Akap6 T C 12: 52,933,816 (GRCm39) L436P probably damaging Het
Axin1 A G 17: 26,409,099 (GRCm39) T700A probably benign Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Ccdc178 T A 18: 22,268,188 (GRCm39) M100L probably benign Het
Ceacam20 T A 7: 19,710,110 (GRCm39) V378E probably benign Het
Cwf19l2 G A 9: 3,410,006 (GRCm39) R45H probably benign Het
Cyp2a5 A G 7: 26,542,410 (GRCm39) I471V possibly damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Ltf A G 9: 110,853,590 (GRCm39) D280G probably benign Het
Nlrc5 A G 8: 95,203,343 (GRCm39) E481G probably benign Het
Or1e30 A G 11: 73,678,060 (GRCm39) T99A probably benign Het
Pald1 G A 10: 61,182,542 (GRCm39) Q412* probably null Het
Ppp4r3c2 G A X: 88,797,709 (GRCm39) V514I probably damaging Het
Ptprd A G 4: 76,018,867 (GRCm39) Y649H probably damaging Het
R3hcc1l T G 19: 42,551,064 (GRCm39) Y20* probably null Het
Rbfox3 G T 11: 118,393,714 (GRCm39) A37D probably damaging Het
Rpa2 A G 4: 132,502,437 (GRCm39) probably null Het
Ryr1 A T 7: 28,752,515 (GRCm39) V3598E probably damaging Het
Slc6a7 G A 18: 61,142,589 (GRCm39) T41M probably damaging Het
Tacc2 G A 7: 130,227,226 (GRCm39) E1323K possibly damaging Het
Ten1 T C 11: 116,096,556 (GRCm39) F70S possibly damaging Het
Terf2 A C 8: 107,806,016 (GRCm39) L312R possibly damaging Het
Tktl1 A G X: 73,221,010 (GRCm39) T39A probably benign Het
Tmem51 A T 4: 141,759,335 (GRCm39) Y138N probably damaging Het
Trp53bp2 T C 1: 182,281,347 (GRCm39) F983L probably damaging Het
Trpm1 G A 7: 63,918,849 (GRCm39) E730K probably damaging Het
Ubxn2a T A 12: 4,941,322 (GRCm39) K95* probably null Het
Xpo6 T C 7: 125,703,893 (GRCm39) N1086D probably damaging Het
Zfp345 T C 2: 150,316,772 (GRCm39) N12D probably benign Het
Other mutations in Ddr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ddr2 APN 1 169,811,996 (GRCm39) missense possibly damaging 0.95
IGL00432:Ddr2 APN 1 169,825,527 (GRCm39) missense probably benign 0.11
IGL00490:Ddr2 APN 1 169,832,763 (GRCm39) missense probably damaging 1.00
IGL01343:Ddr2 APN 1 169,812,150 (GRCm39) missense probably benign
IGL01898:Ddr2 APN 1 169,825,725 (GRCm39) missense possibly damaging 0.85
IGL01899:Ddr2 APN 1 169,811,991 (GRCm39) missense probably damaging 1.00
IGL01906:Ddr2 APN 1 169,809,668 (GRCm39) missense probably damaging 1.00
IGL02115:Ddr2 APN 1 169,822,278 (GRCm39) missense probably benign
IGL02330:Ddr2 APN 1 169,816,093 (GRCm39) missense probably damaging 0.99
IGL02740:Ddr2 APN 1 169,812,514 (GRCm39) missense probably damaging 1.00
IGL02828:Ddr2 APN 1 169,816,082 (GRCm39) missense probably benign 0.34
built UTSW 1 169,825,533 (GRCm39) missense probably damaging 1.00
commie UTSW 1 169,829,552 (GRCm39) missense possibly damaging 0.82
debulked UTSW 1 169,809,667 (GRCm39) missense probably damaging 1.00
Demokratische UTSW 1 169,809,672 (GRCm39) missense probably damaging 1.00
deutsche UTSW 1 169,812,530 (GRCm39) missense probably damaging 1.00
fibro UTSW 1 169,832,381 (GRCm39) splice site probably benign
fingers UTSW 1 169,816,109 (GRCm39) missense probably benign 0.16
Julio UTSW 1 169,825,498 (GRCm39) critical splice donor site probably null
phalanges UTSW 1 169,832,809 (GRCm39) nonsense probably null
revolta UTSW 1 169,816,089 (GRCm39) nonsense probably null
ripper UTSW 1 169,805,483 (GRCm39) nonsense probably null
Underrepresented UTSW 1 169,825,701 (GRCm39) missense probably benign 0.01
R0574:Ddr2 UTSW 1 169,809,532 (GRCm39) splice site probably benign
R0730:Ddr2 UTSW 1 169,823,135 (GRCm39) missense probably benign
R0733:Ddr2 UTSW 1 169,832,381 (GRCm39) splice site probably benign
R0883:Ddr2 UTSW 1 169,822,198 (GRCm39) missense probably benign 0.01
R1340:Ddr2 UTSW 1 169,825,653 (GRCm39) missense probably benign
R1815:Ddr2 UTSW 1 169,823,170 (GRCm39) nonsense probably null
R1921:Ddr2 UTSW 1 169,831,814 (GRCm39) missense probably damaging 1.00
R1924:Ddr2 UTSW 1 169,809,641 (GRCm39) missense probably benign 0.01
R2016:Ddr2 UTSW 1 169,812,537 (GRCm39) missense probably damaging 1.00
R2079:Ddr2 UTSW 1 169,832,345 (GRCm39) nonsense probably null
R2178:Ddr2 UTSW 1 169,822,251 (GRCm39) missense probably benign 0.18
R2903:Ddr2 UTSW 1 169,825,730 (GRCm39) missense probably damaging 1.00
R3971:Ddr2 UTSW 1 169,815,986 (GRCm39) missense probably damaging 1.00
R4290:Ddr2 UTSW 1 169,818,178 (GRCm39) missense probably benign 0.00
R4494:Ddr2 UTSW 1 169,815,983 (GRCm39) missense probably damaging 1.00
R4606:Ddr2 UTSW 1 169,829,421 (GRCm39) missense probably benign 0.05
R4721:Ddr2 UTSW 1 169,832,809 (GRCm39) nonsense probably null
R4734:Ddr2 UTSW 1 169,825,657 (GRCm39) missense probably benign 0.41
R4855:Ddr2 UTSW 1 169,816,066 (GRCm39) missense possibly damaging 0.94
R4871:Ddr2 UTSW 1 169,832,340 (GRCm39) missense probably benign 0.19
R4923:Ddr2 UTSW 1 169,825,498 (GRCm39) critical splice donor site probably null
R5207:Ddr2 UTSW 1 169,812,530 (GRCm39) missense probably damaging 1.00
R5325:Ddr2 UTSW 1 169,829,406 (GRCm39) missense probably benign 0.00
R5439:Ddr2 UTSW 1 169,832,298 (GRCm39) missense possibly damaging 0.92
R5723:Ddr2 UTSW 1 169,816,089 (GRCm39) nonsense probably null
R5833:Ddr2 UTSW 1 169,832,265 (GRCm39) missense probably benign 0.01
R5924:Ddr2 UTSW 1 169,822,197 (GRCm39) missense probably benign 0.03
R6020:Ddr2 UTSW 1 169,832,671 (GRCm39) missense probably benign 0.15
R6270:Ddr2 UTSW 1 169,816,109 (GRCm39) missense probably benign 0.16
R6326:Ddr2 UTSW 1 169,814,709 (GRCm39) missense probably damaging 1.00
R6328:Ddr2 UTSW 1 169,814,634 (GRCm39) missense possibly damaging 0.52
R6794:Ddr2 UTSW 1 169,809,667 (GRCm39) missense probably damaging 1.00
R6925:Ddr2 UTSW 1 169,825,701 (GRCm39) missense probably benign 0.01
R7011:Ddr2 UTSW 1 169,809,672 (GRCm39) missense probably damaging 1.00
R7185:Ddr2 UTSW 1 169,814,623 (GRCm39) missense probably damaging 1.00
R7248:Ddr2 UTSW 1 169,822,198 (GRCm39) missense probably benign 0.01
R7278:Ddr2 UTSW 1 169,812,530 (GRCm39) missense probably damaging 1.00
R7343:Ddr2 UTSW 1 169,809,647 (GRCm39) missense probably damaging 1.00
R7366:Ddr2 UTSW 1 169,825,533 (GRCm39) missense probably damaging 1.00
R7520:Ddr2 UTSW 1 169,812,008 (GRCm39) missense probably damaging 1.00
R7571:Ddr2 UTSW 1 169,829,420 (GRCm39) missense probably benign 0.05
R7611:Ddr2 UTSW 1 169,825,727 (GRCm39) missense possibly damaging 0.73
R8425:Ddr2 UTSW 1 169,863,585 (GRCm39) start gained probably benign
R8728:Ddr2 UTSW 1 169,829,552 (GRCm39) missense possibly damaging 0.82
R8819:Ddr2 UTSW 1 169,805,483 (GRCm39) nonsense probably null
R8820:Ddr2 UTSW 1 169,805,483 (GRCm39) nonsense probably null
R9328:Ddr2 UTSW 1 169,829,504 (GRCm39) missense probably benign 0.00
X0004:Ddr2 UTSW 1 169,814,667 (GRCm39) missense probably benign 0.10
X0027:Ddr2 UTSW 1 169,809,599 (GRCm39) missense probably damaging 1.00
Z1176:Ddr2 UTSW 1 169,825,653 (GRCm39) missense probably benign
Z1176:Ddr2 UTSW 1 169,825,652 (GRCm39) missense probably benign
Z1176:Ddr2 UTSW 1 169,812,524 (GRCm39) missense probably damaging 1.00
Z1177:Ddr2 UTSW 1 169,818,191 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TAGGGAATCCACAGCTCTTAAGC -3'
(R):5'- CATGTCTTCTCAGGGTGCAGTG -3'

Sequencing Primer
(F):5'- CTCTTAAGCAAAGATGAGATTGACC -3'
(R):5'- GGTGTTGTGAAGCCGGCC -3'
Posted On 2015-02-05