Incidental Mutation 'R3052:Cldn8'
ID265008
Institutional Source Beutler Lab
Gene Symbol Cldn8
Ensembl Gene ENSMUSG00000050520
Gene Nameclaudin 8
Synonyms
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R3052 (G1)
Quality Score224
Status Validated
Chromosome16
Chromosomal Location88560828-88563183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88562731 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 102 (M102R)
Ref Sequence ENSEMBL: ENSMUSP00000051887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049697]
Predicted Effect probably damaging
Transcript: ENSMUST00000049697
AA Change: M102R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051887
Gene: ENSMUSG00000050520
AA Change: M102R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2.9e-32 PFAM
Pfam:Claudin_2 15 184 5.6e-10 PFAM
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a paracellular cation barrier. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Cldn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02888:Cldn8 APN 16 88562383 missense probably benign 0.00
R0038:Cldn8 UTSW 16 88563034 start codon destroyed probably null 1.00
R0038:Cldn8 UTSW 16 88563034 start codon destroyed probably null 1.00
R0332:Cldn8 UTSW 16 88562358 synonymous silent
R0690:Cldn8 UTSW 16 88562639 missense probably damaging 1.00
R1496:Cldn8 UTSW 16 88562401 missense probably benign
R1832:Cldn8 UTSW 16 88562858 missense probably benign 0.07
R3053:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4428:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4429:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4430:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4431:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4465:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4485:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4659:Cldn8 UTSW 16 88562408 missense probably benign
R4660:Cldn8 UTSW 16 88562408 missense probably benign
R4662:Cldn8 UTSW 16 88562408 missense probably benign
R4679:Cldn8 UTSW 16 88562408 missense probably benign
R4741:Cldn8 UTSW 16 88562408 missense probably benign
R6590:Cldn8 UTSW 16 88562535 missense possibly damaging 0.73
R6691:Cldn8 UTSW 16 88562535 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTTAGGGCCACATCCACCAG -3'
(R):5'- GACTATCATGCCTCAGTGGAGAG -3'

Sequencing Primer
(F):5'- CCAGTGGGTTGTAGAAGTCTC -3'
(R):5'- AGAGTGTCTGCCTTCATCGAAAG -3'
Posted On2015-02-05