Incidental Mutation 'R3053:Olfr351'
ID265021
Institutional Source Beutler Lab
Gene Symbol Olfr351
Ensembl Gene ENSMUSG00000075383
Gene Nameolfactory receptor 351
SynonymsMOR127-2, GA_x6K02T2NLDC-33554926-33553994
MMRRC Submission 040562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3053 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36857539-36862660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36859947 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 134 (M134L)
Ref Sequence ENSEMBL: ENSMUSP00000150346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100150] [ENSMUST00000213676] [ENSMUST00000215137]
Predicted Effect probably benign
Transcript: ENSMUST00000100150
AA Change: M134L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097727
Gene: ENSMUSG00000075383
AA Change: M134L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.7e-56 PFAM
Pfam:7tm_1 39 288 5.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213676
AA Change: M134L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000215137
AA Change: M134L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Agl T A 3: 116,791,033 I213F probably damaging Het
Arap2 A G 5: 62,748,857 V273A probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
Bcl11b T C 12: 107,916,001 E613G probably benign Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Dmtf1 G T 5: 9,129,316 T206K probably damaging Het
Dner G T 1: 84,384,026 Q621K probably damaging Het
Fam92a G C 4: 12,157,767 probably null Het
Gmppa A G 1: 75,441,756 Y261C probably benign Het
Lama5 C T 2: 180,183,067 R2519K probably damaging Het
Mical2 G T 7: 112,311,423 A267S probably damaging Het
Nrxn3 A T 12: 89,255,101 D550V probably damaging Het
Pole A T 5: 110,289,795 D73V probably damaging Het
Ppm1b G A 17: 85,013,846 R472K probably benign Het
Ppm1m A G 9: 106,198,675 I18T probably benign Het
Psg18 C T 7: 18,349,193 G225R probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rapgef1 T C 2: 29,724,856 I817T probably damaging Het
Rasal3 T C 17: 32,403,439 E4G probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc15a4 A T 5: 127,596,682 V556E possibly damaging Het
Spats2l A G 1: 57,900,766 K193R probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Tedc1 G T 12: 113,156,467 probably benign Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tmem132d A C 5: 127,792,474 S599A probably benign Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt2a2 A T 5: 87,474,469 N213K probably damaging Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zbed5 A T 5: 129,902,146 H312L possibly damaging Het
Zfp729b A G 13: 67,593,466 Y227H probably damaging Het
Other mutations in Olfr351
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Olfr351 APN 2 36859775 missense probably benign 0.04
IGL02481:Olfr351 APN 2 36859818 missense probably damaging 0.96
IGL02673:Olfr351 APN 2 36860176 missense probably benign 0.25
IGL02754:Olfr351 APN 2 36860220 missense probably damaging 1.00
P0041:Olfr351 UTSW 2 36859461 missense probably damaging 1.00
R1392:Olfr351 UTSW 2 36860175 missense probably damaging 1.00
R1392:Olfr351 UTSW 2 36860175 missense probably damaging 1.00
R2271:Olfr351 UTSW 2 36859625 missense probably damaging 1.00
R2274:Olfr351 UTSW 2 36860101 missense probably damaging 0.99
R4712:Olfr351 UTSW 2 36860369 splice site probably null
R5001:Olfr351 UTSW 2 36860070 missense probably benign 0.00
R5364:Olfr351 UTSW 2 36859994 missense probably damaging 1.00
R5502:Olfr351 UTSW 2 36860270 missense probably damaging 0.98
R6048:Olfr351 UTSW 2 36859841 missense probably benign 0.00
R6401:Olfr351 UTSW 2 36860165 nonsense probably null
R7353:Olfr351 UTSW 2 36859668 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGGACCATGAGTACTGTACC -3'
(R):5'- GGCCAACTTGTCCTTTGCTG -3'

Sequencing Primer
(F):5'- TGAGTACTGTACCCCCTAAGG -3'
(R):5'- CATCTACAGTGACCAAGATGTTG -3'
Posted On2015-02-05