Incidental Mutation 'R3053:Pole'
ID265028
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Namepolymerase (DNA directed), epsilon
Synonymspol-epsilon
MMRRC Submission 040562-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3053 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110286306-110337474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110289795 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 73 (D73V)
Ref Sequence ENSEMBL: ENSMUSP00000108101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000031472] [ENSMUST00000112482] [ENSMUST00000155266]
Predicted Effect probably damaging
Transcript: ENSMUST00000007296
AA Change: D73V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: D73V

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031472
SMART Domains Protein: ENSMUSP00000031472
Gene: ENSMUSG00000029499

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
Pfam:Mpv17_PMP22 128 192 2.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112482
AA Change: D73V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108101
Gene: ENSMUSG00000007080
AA Change: D73V

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 86 190 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141550
Predicted Effect probably benign
Transcript: ENSMUST00000155266
SMART Domains Protein: ENSMUSP00000117729
Gene: ENSMUSG00000029499

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Agl T A 3: 116,791,033 I213F probably damaging Het
Arap2 A G 5: 62,748,857 V273A probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
Bcl11b T C 12: 107,916,001 E613G probably benign Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Dmtf1 G T 5: 9,129,316 T206K probably damaging Het
Dner G T 1: 84,384,026 Q621K probably damaging Het
Fam92a G C 4: 12,157,767 probably null Het
Gmppa A G 1: 75,441,756 Y261C probably benign Het
Lama5 C T 2: 180,183,067 R2519K probably damaging Het
Mical2 G T 7: 112,311,423 A267S probably damaging Het
Nrxn3 A T 12: 89,255,101 D550V probably damaging Het
Olfr351 T A 2: 36,859,947 M134L probably benign Het
Ppm1b G A 17: 85,013,846 R472K probably benign Het
Ppm1m A G 9: 106,198,675 I18T probably benign Het
Psg18 C T 7: 18,349,193 G225R probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rapgef1 T C 2: 29,724,856 I817T probably damaging Het
Rasal3 T C 17: 32,403,439 E4G probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc15a4 A T 5: 127,596,682 V556E possibly damaging Het
Spats2l A G 1: 57,900,766 K193R probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Tedc1 G T 12: 113,156,467 probably benign Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tmem132d A C 5: 127,792,474 S599A probably benign Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt2a2 A T 5: 87,474,469 N213K probably damaging Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zbed5 A T 5: 129,902,146 H312L possibly damaging Het
Zfp729b A G 13: 67,593,466 Y227H probably damaging Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCAGTTCTTACAAAGGTGGTGTC -3'
(R):5'- TGAGCAACCTGGACACAAG -3'

Sequencing Primer
(F):5'- CTTACAAAGGTGGTGTCTATGTAAG -3'
(R):5'- GAACTGGAGTTACAGACAGCCTTTC -3'
Posted On2015-02-05