Incidental Mutation 'R3056:1700015F17Rik'
List |< first << previous [record 12 of 9592] next >> last >|
ID265174
Institutional Source Beutler Lab
Gene Symbol 1700015F17Rik
Ensembl Gene ENSMUSG00000079666
Gene NameRIKEN cDNA 1700015F17 gene
SynonymsLOC381716
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location5437827-5479143 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 5457283 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115447] [ENSMUST00000128151] [ENSMUST00000156282]
Predicted Effect probably null
Transcript: ENSMUST00000115447
SMART Domains Protein: ENSMUSP00000111107
Gene: ENSMUSG00000079666

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128151
Predicted Effect probably benign
Transcript: ENSMUST00000156282
SMART Domains Protein: ENSMUSP00000122651
Gene: ENSMUSG00000079666

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in 1700015F17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02125:1700015F17Rik APN 5 5450644 makesense probably null
IGL02701:1700015F17Rik APN 5 5466623 critical splice donor site probably null
IGL02821:1700015F17Rik APN 5 5452039 nonsense probably null
R1029:1700015F17Rik UTSW 5 5455919 missense probably benign 0.21
R1463:1700015F17Rik UTSW 5 5452073 splice site probably benign
R1525:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1550:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1764:1700015F17Rik UTSW 5 5478943 missense possibly damaging 0.83
R1911:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1912:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1930:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1931:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R2013:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2014:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2015:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2151:1700015F17Rik UTSW 5 5478875 missense possibly damaging 0.46
R2420:1700015F17Rik UTSW 5 5455912 missense probably benign 0.00
R2421:1700015F17Rik UTSW 5 5455912 missense probably benign 0.00
R4012:1700015F17Rik UTSW 5 5478955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTAAGAGCTCTACCTGACTC -3'
(R):5'- TGGCATCTACAGACCACCAATG -3'

Sequencing Primer
(F):5'- GAGCTCTACCTGACTCAACTTATATC -3'
(R):5'- GTATTTGGTGCCGAGAAG -3'
Posted On2015-02-05