Incidental Mutation 'R3076:Nrsn1'
ID265231
Institutional Source Beutler Lab
Gene Symbol Nrsn1
Ensembl Gene ENSMUSG00000048978
Gene Nameneurensin 1
SynonymsNeurensin-1, Neuro-p24, Vmp
MMRRC Submission 040566-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3076 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location25252040-25270502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25253559 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 129 (T129A)
Ref Sequence ENSEMBL: ENSMUSP00000128979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057866] [ENSMUST00000167305]
Predicted Effect probably benign
Transcript: ENSMUST00000057866
AA Change: T129A

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055048
Gene: ENSMUSG00000048978
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Neurensin 24 154 2.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156448
Predicted Effect probably benign
Transcript: ENSMUST00000167305
AA Change: T129A

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128979
Gene: ENSMUSG00000048978
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Neurensin 24 159 3.6e-57 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A C 13: 63,240,115 D3A probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Amigo2 C T 15: 97,245,434 R369Q probably damaging Het
Arfgef3 T C 10: 18,603,530 I1446V probably damaging Het
Ascc2 T A 11: 4,672,446 L504Q probably damaging Het
Atp1a3 A G 7: 24,980,073 V932A possibly damaging Het
Cabcoco1 T G 10: 68,525,645 Y8S possibly damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Col18a1 T C 10: 77,088,928 K9R possibly damaging Het
Dlgap3 A G 4: 127,195,706 Y365C probably damaging Het
Dock3 T C 9: 106,941,526 probably null Het
Gtf3c4 A T 2: 28,835,153 V189E possibly damaging Het
Khdc3 C A 9: 73,102,930 F89L probably damaging Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Magi1 T C 6: 93,757,687 Q393R possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mrgpre C T 7: 143,781,296 A157T probably benign Het
Mtpn C T 6: 35,521,944 V76I possibly damaging Het
Nbeal2 A T 9: 110,631,700 W1702R probably damaging Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Nyap2 T C 1: 81,241,971 probably null Het
Olfr108 T C 17: 37,445,484 probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Ptprb T C 10: 116,344,026 S1450P probably damaging Het
Sh2d2a T C 3: 87,852,170 I296T probably benign Het
Shtn1 T C 19: 58,995,086 E471G probably damaging Het
St7 T G 6: 17,846,238 Y163* probably null Het
Svil T C 18: 5,116,055 S1623P probably damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn1r223 G A 13: 23,250,165 A310T probably benign Het
Zfp647 A T 15: 76,918,009 M1K probably null Het
Other mutations in Nrsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Nrsn1 APN 13 25253544 missense probably damaging 0.97
IGL03127:Nrsn1 APN 13 25253717 missense probably damaging 0.97
R0549:Nrsn1 UTSW 13 25262258 missense probably benign 0.01
R4804:Nrsn1 UTSW 13 25253597 missense probably benign 0.40
R6020:Nrsn1 UTSW 13 25253372 missense probably damaging 1.00
R7094:Nrsn1 UTSW 13 25253741 missense possibly damaging 0.85
R7116:Nrsn1 UTSW 13 25253405 missense probably damaging 0.99
R7226:Nrsn1 UTSW 13 25253468 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTGAGGTGACAAATGTTTC -3'
(R):5'- AGGCACTGTCTTTGTGATTCTC -3'

Sequencing Primer
(F):5'- AGAGGCTGCACATTCTGAACTCTG -3'
(R):5'- TGTGATTCTCGGACTAACTGTC -3'
Posted On2015-02-05