Incidental Mutation 'R3076:2010111I01Rik'
List |< first << previous [record 39 of 10171] next >> last >|
ID265232
Institutional Source Beutler Lab
Gene Symbol 2010111I01Rik
Ensembl Gene ENSMUSG00000021458
Gene NameRIKEN cDNA 2010111I01 gene
SynonymsApO, aminopeptidase O
MMRRC Submission 040566-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R3076 (G1)
Quality Score106
Status Not validated
Chromosome13
Chromosomal Location62964893-63326096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 63240115 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 3 (D3A)
Ref Sequence ENSEMBL: ENSMUSP00000152100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560] [ENSMUST00000220884]
Predicted Effect probably benign
Transcript: ENSMUST00000021911
AA Change: D670A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: D670A

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 221 359 5.4e-11 PFAM
Pfam:Peptidase_M1 385 558 2.3e-15 PFAM
Pfam:Peptidase_MA_2 453 613 1.3e-12 PFAM
Leuk-A4-hydro_C 675 821 3.02e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091560
AA Change: D671A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: D671A

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 220 359 2.7e-11 PFAM
Pfam:Peptidase_M1 386 561 1.9e-15 PFAM
Leuk-A4-hydro_C 676 822 3.02e-37 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159152
AA Change: D14A
SMART Domains Protein: ENSMUSP00000124560
Gene: ENSMUSG00000021458
AA Change: D14A

DomainStartEndE-ValueType
Leuk-A4-hydro_C 1 113 4.63e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220806
Predicted Effect unknown
Transcript: ENSMUST00000220863
AA Change: D562A
Predicted Effect probably damaging
Transcript: ENSMUST00000220884
AA Change: D3A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000221676
Predicted Effect unknown
Transcript: ENSMUST00000221820
AA Change: D7A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221938
Predicted Effect probably benign
Transcript: ENSMUST00000222282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222680
Predicted Effect unknown
Transcript: ENSMUST00000222929
AA Change: D29A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223185
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Amigo2 C T 15: 97,245,434 R369Q probably damaging Het
Arfgef3 T C 10: 18,603,530 I1446V probably damaging Het
Ascc2 T A 11: 4,672,446 L504Q probably damaging Het
Atp1a3 A G 7: 24,980,073 V932A possibly damaging Het
Cabcoco1 T G 10: 68,525,645 Y8S possibly damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Col18a1 T C 10: 77,088,928 K9R possibly damaging Het
Dlgap3 A G 4: 127,195,706 Y365C probably damaging Het
Dock3 T C 9: 106,941,526 probably null Het
Gtf3c4 A T 2: 28,835,153 V189E possibly damaging Het
Khdc3 C A 9: 73,102,930 F89L probably damaging Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Magi1 T C 6: 93,757,687 Q393R possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Meis1 A T 11: 19,011,254 N206K probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mrgpre C T 7: 143,781,296 A157T probably benign Het
Mtpn C T 6: 35,521,944 V76I possibly damaging Het
Nbeal2 A T 9: 110,631,700 W1702R probably damaging Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrsn1 T C 13: 25,253,559 T129A probably benign Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Nyap2 T C 1: 81,241,971 probably null Het
Olfr108 T C 17: 37,445,484 probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Ptprb T C 10: 116,344,026 S1450P probably damaging Het
Sh2d2a T C 3: 87,852,170 I296T probably benign Het
Shtn1 T C 19: 58,995,086 E471G probably damaging Het
St7 T G 6: 17,846,238 Y163* probably null Het
Svil T C 18: 5,116,055 S1623P probably damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn1r223 G A 13: 23,250,165 A310T probably benign Het
Zfp647 A T 15: 76,918,009 M1K probably null Het
Other mutations in 2010111I01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:2010111I01Rik APN 13 63199500 splice site probably benign
IGL00329:2010111I01Rik APN 13 63191163 missense probably damaging 1.00
IGL00336:2010111I01Rik APN 13 63015423 missense possibly damaging 0.78
IGL01384:2010111I01Rik APN 13 63190476 splice site probably benign
IGL01780:2010111I01Rik APN 13 63210125 missense probably benign 0.00
IGL01876:2010111I01Rik APN 13 63190522 missense probably damaging 1.00
IGL02096:2010111I01Rik APN 13 63061089 missense probably benign 0.04
IGL02166:2010111I01Rik APN 13 63015453 missense probably benign 0.02
IGL02184:2010111I01Rik APN 13 63068111 missense possibly damaging 0.50
R0139:2010111I01Rik UTSW 13 63190484 missense probably benign 0.01
R1209:2010111I01Rik UTSW 13 63191064 unclassified probably null
R1233:2010111I01Rik UTSW 13 63199520 missense probably damaging 0.96
R1756:2010111I01Rik UTSW 13 63068061 missense possibly damaging 0.95
R1786:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R1861:2010111I01Rik UTSW 13 63015783 missense probably damaging 1.00
R2130:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R2131:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R3702:2010111I01Rik UTSW 13 63015330 missense probably benign 0.01
R3912:2010111I01Rik UTSW 13 63156706 nonsense probably null
R4512:2010111I01Rik UTSW 13 63156667 missense probably damaging 0.99
R4593:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4596:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4597:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4616:2010111I01Rik UTSW 13 63298751 missense probably damaging 1.00
R4625:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4627:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4630:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4632:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4911:2010111I01Rik UTSW 13 63170939 critical splice acceptor site probably null
R5204:2010111I01Rik UTSW 13 63033090 missense probably benign 0.15
R5210:2010111I01Rik UTSW 13 63068110 missense probably benign 0.00
R5849:2010111I01Rik UTSW 13 63015498 missense probably benign 0.00
R5861:2010111I01Rik UTSW 13 63298812 missense probably damaging 1.00
R5960:2010111I01Rik UTSW 13 63240273 missense probably damaging 0.99
R6021:2010111I01Rik UTSW 13 63061082 missense probably damaging 1.00
R6048:2010111I01Rik UTSW 13 63240325 missense probably damaging 0.99
R6379:2010111I01Rik UTSW 13 63068243 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTGAGAACAATAACAGCCAGG -3'
(R):5'- AGGGCCTCCTACCTTTTCAAAG -3'

Sequencing Primer
(F):5'- GACCTGGGAGCCTACACCTTTAAG -3'
(R):5'- CCCTCGTTTGCGTTTTCGGG -3'
Posted On2015-02-05