Incidental Mutation 'R3077:Pwwp2a'
ID265262
Institutional Source Beutler Lab
Gene Symbol Pwwp2a
Ensembl Gene ENSMUSG00000044950
Gene NamePWWP domain containing 2A
Synonyms
MMRRC Submission 040567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R3077 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location43681998-43721491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43705385 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 184 (N184S)
Ref Sequence ENSEMBL: ENSMUSP00000104903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061070] [ENSMUST00000094294] [ENSMUST00000109280]
Predicted Effect probably damaging
Transcript: ENSMUST00000061070
AA Change: N459S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054154
Gene: ENSMUSG00000044950
AA Change: N459S

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 488 509 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 566 576 N/A INTRINSIC
low complexity region 588 598 N/A INTRINSIC
Pfam:PWWP 628 714 5.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094294
AA Change: N459S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091852
Gene: ENSMUSG00000044950
AA Change: N459S

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109280
AA Change: N184S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104903
Gene: ENSMUSG00000044950
AA Change: N184S

DomainStartEndE-ValueType
low complexity region 213 234 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 291 301 N/A INTRINSIC
low complexity region 313 323 N/A INTRINSIC
Pfam:PWWP 353 438 2.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129229
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Arfgef3 T C 10: 18,603,530 I1446V probably damaging Het
Cabcoco1 T G 10: 68,525,645 Y8S possibly damaging Het
Champ1 T C 8: 13,878,832 V330A probably benign Het
Dnajc8 A G 4: 132,544,663 D70G probably damaging Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Mnt G C 11: 74,843,110 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Olfr576 G T 7: 102,966,016 K305N probably benign Het
Pcdhb11 C T 18: 37,422,244 T209I probably benign Het
Pdzd8 A G 19: 59,305,156 probably null Het
Phactr4 A G 4: 132,397,996 M1T probably null Het
Shprh T C 10: 11,170,413 V958A probably damaging Het
Smc3 A G 19: 53,627,891 E449G probably benign Het
Snap91 T A 9: 86,838,854 Y96F possibly damaging Het
Trim34b A G 7: 104,331,301 R199G possibly damaging Het
Unc45a A C 7: 80,338,932 V112G probably damaging Het
Vwa8 A T 14: 79,098,342 N1413Y probably benign Het
Zcchc9 A T 13: 91,805,982 N51K probably benign Het
Zfp628 A G 7: 4,921,200 E807G possibly damaging Het
Zfp647 A T 15: 76,918,009 M1K probably null Het
Other mutations in Pwwp2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Pwwp2a APN 11 43706128 missense possibly damaging 0.46
IGL02227:Pwwp2a APN 11 43705621 missense possibly damaging 0.93
IGL02653:Pwwp2a APN 11 43706035 missense possibly damaging 0.69
IGL03258:Pwwp2a APN 11 43704565 missense probably benign 0.21
R0376:Pwwp2a UTSW 11 43704672 missense probably benign 0.00
R1465:Pwwp2a UTSW 11 43705556 missense possibly damaging 0.95
R1465:Pwwp2a UTSW 11 43705556 missense possibly damaging 0.95
R2127:Pwwp2a UTSW 11 43705318 missense probably benign 0.13
R2128:Pwwp2a UTSW 11 43705318 missense probably benign 0.13
R2173:Pwwp2a UTSW 11 43682486 missense probably benign 0.01
R3436:Pwwp2a UTSW 11 43706188 nonsense probably null
R3437:Pwwp2a UTSW 11 43706188 nonsense probably null
R4427:Pwwp2a UTSW 11 43682517 missense possibly damaging 0.52
R5597:Pwwp2a UTSW 11 43682595 missense probably benign 0.34
R5672:Pwwp2a UTSW 11 43706141 missense probably damaging 1.00
R6132:Pwwp2a UTSW 11 43705628 missense probably damaging 1.00
R6197:Pwwp2a UTSW 11 43704596 missense probably benign 0.00
R6563:Pwwp2a UTSW 11 43705765 missense possibly damaging 0.88
R6709:Pwwp2a UTSW 11 43704727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGATCACGCAAAAGCTCG -3'
(R):5'- TTGCCCAACATCCGCAGTTC -3'

Sequencing Primer
(F):5'- CTCGGGAAGTATTGAAAATTGCC -3'
(R):5'- TGCTCACCAGGCACACG -3'
Posted On2015-02-05