Incidental Mutation 'R3077:Zfp647'
ID265267
Institutional Source Beutler Lab
Gene Symbol Zfp647
Ensembl Gene ENSMUSG00000054967
Gene Namezinc finger protein 647
Synonyms
MMRRC Submission 040567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3077 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76910371-76925448 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 76918009 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000155660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048854] [ENSMUST00000229055] [ENSMUST00000229865] [ENSMUST00000230677]
Predicted Effect probably null
Transcript: ENSMUST00000048854
AA Change: M1K
SMART Domains Protein: ENSMUSP00000041575
Gene: ENSMUSG00000054967
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 17 77 7.05e-33 SMART
ZnF_C2H2 174 196 3.39e-3 SMART
ZnF_C2H2 202 224 1.2e-3 SMART
ZnF_C2H2 230 252 2.95e-3 SMART
ZnF_C2H2 258 280 4.79e-3 SMART
ZnF_C2H2 286 308 1.84e-4 SMART
ZnF_C2H2 314 336 6.32e-3 SMART
ZnF_C2H2 342 364 7.37e-4 SMART
ZnF_C2H2 370 392 1.6e-4 SMART
ZnF_C2H2 398 420 2.2e-2 SMART
ZnF_C2H2 426 448 6.78e-3 SMART
ZnF_C2H2 454 476 4.87e-4 SMART
ZnF_C2H2 482 504 2.24e-3 SMART
ZnF_C2H2 510 532 9.08e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000229055
AA Change: M1K
Predicted Effect probably null
Transcript: ENSMUST00000229865
AA Change: M1K
Predicted Effect probably null
Transcript: ENSMUST00000230677
AA Change: M1K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Arfgef3 T C 10: 18,603,530 I1446V probably damaging Het
Cabcoco1 T G 10: 68,525,645 Y8S possibly damaging Het
Champ1 T C 8: 13,878,832 V330A probably benign Het
Dnajc8 A G 4: 132,544,663 D70G probably damaging Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Mnt G C 11: 74,843,110 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Olfr576 G T 7: 102,966,016 K305N probably benign Het
Pcdhb11 C T 18: 37,422,244 T209I probably benign Het
Pdzd8 A G 19: 59,305,156 probably null Het
Phactr4 A G 4: 132,397,996 M1T probably null Het
Pwwp2a A G 11: 43,705,385 N184S probably damaging Het
Shprh T C 10: 11,170,413 V958A probably damaging Het
Smc3 A G 19: 53,627,891 E449G probably benign Het
Snap91 T A 9: 86,838,854 Y96F possibly damaging Het
Trim34b A G 7: 104,331,301 R199G possibly damaging Het
Unc45a A C 7: 80,338,932 V112G probably damaging Het
Vwa8 A T 14: 79,098,342 N1413Y probably benign Het
Zcchc9 A T 13: 91,805,982 N51K probably benign Het
Zfp628 A G 7: 4,921,200 E807G possibly damaging Het
Other mutations in Zfp647
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:Zfp647 APN 15 76911670 nonsense probably null
IGL01680:Zfp647 APN 15 76917768 splice site probably benign
IGL02647:Zfp647 APN 15 76917715 missense probably damaging 1.00
IGL03213:Zfp647 APN 15 76911977 missense possibly damaging 0.46
IGL03401:Zfp647 APN 15 76911368 missense probably damaging 1.00
R0418:Zfp647 UTSW 15 76911386 missense probably damaging 1.00
R1479:Zfp647 UTSW 15 76911203 missense possibly damaging 0.94
R1913:Zfp647 UTSW 15 76911951 missense probably benign 0.02
R1959:Zfp647 UTSW 15 76911114 missense possibly damaging 0.57
R2176:Zfp647 UTSW 15 76911660 missense probably damaging 1.00
R3076:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3701:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3702:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3960:Zfp647 UTSW 15 76910976 unclassified probably null
R4938:Zfp647 UTSW 15 76911044 frame shift probably null
R4939:Zfp647 UTSW 15 76911044 frame shift probably null
R5196:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5197:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5345:Zfp647 UTSW 15 76911495 missense possibly damaging 0.48
R5415:Zfp647 UTSW 15 76911393 missense possibly damaging 0.79
R5791:Zfp647 UTSW 15 76918006 missense unknown
R5942:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5944:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5945:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5946:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5947:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6005:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6007:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6073:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6074:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6101:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6102:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6103:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6126:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6127:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6129:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6136:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6151:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6305:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6306:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6329:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6721:Zfp647 UTSW 15 76911876 missense probably benign 0.00
R7158:Zfp647 UTSW 15 76917305 missense probably benign 0.01
R7239:Zfp647 UTSW 15 76911756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCACGTGAGCTCCATAGG -3'
(R):5'- GGAACCATATGTTTGCTCAGGAC -3'

Sequencing Primer
(F):5'- CACGTGAGCTCCATAGGCAGAG -3'
(R):5'- TGCTCAGGACTCTATACTAAAGAAC -3'
Posted On2015-02-05