Incidental Mutation 'R3078:Meis1'
ID265298
Institutional Source Beutler Lab
Gene Symbol Meis1
Ensembl Gene ENSMUSG00000020160
Gene NameMeis homeobox 1
SynonymsC530044H18Rik
MMRRC Submission 040568-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3078 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location18879817-19018985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19011254 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 206 (N206K)
Ref Sequence ENSEMBL: ENSMUSP00000099942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068264] [ENSMUST00000102878] [ENSMUST00000144988] [ENSMUST00000177417] [ENSMUST00000185131]
Predicted Effect probably benign
Transcript: ENSMUST00000068264
AA Change: N206K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000069277
Gene: ENSMUSG00000020160
AA Change: N206K

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102878
AA Change: N206K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099942
Gene: ENSMUSG00000020160
AA Change: N206K

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
Pfam:Meis_PKNOX_N 108 192 5.5e-48 PFAM
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117191
SMART Domains Protein: ENSMUSP00000113121
Gene: ENSMUSG00000084085

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118661
SMART Domains Protein: ENSMUSP00000112809
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
HOX 92 157 5.3e-14 SMART
low complexity region 192 205 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143706
Predicted Effect probably benign
Transcript: ENSMUST00000144988
AA Change: N206K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134969
Gene: ENSMUSG00000020160
AA Change: N206K

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 358 369 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152073
Predicted Effect unknown
Transcript: ENSMUST00000177357
AA Change: N178K
Predicted Effect probably benign
Transcript: ENSMUST00000177417
AA Change: N206K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135726
Gene: ENSMUSG00000020160
AA Change: N206K

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185131
AA Change: N206K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139219
Gene: ENSMUSG00000020160
AA Change: N206K

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193315
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 93% (42/45)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die during gestation and exhibit eye, vasculature, and hematopoietic defects. Mice homozygous for a conditional allele activated in HSCs exhibit altered bone marrow cell development, altered HSC physiology and increased reactive oxygen species production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G C 5: 24,546,666 T528S probably benign Het
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Actr3b A G 5: 25,822,442 Y37C probably damaging Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Alg10b T C 15: 90,227,936 S328P probably benign Het
C5ar2 G A 7: 16,237,424 R193C probably damaging Het
Cct8 A G 16: 87,488,877 V231A possibly damaging Het
Clca4a C T 3: 144,968,253 M240I probably damaging Het
Cmya5 A T 13: 93,048,927 I3520N probably damaging Het
Dock6 G T 9: 21,845,754 probably benign Het
Dynlrb1 T A 2: 155,249,945 I99N probably damaging Het
Ebf4 G A 2: 130,306,499 D77N probably damaging Het
Fam196a A G 7: 134,918,021 I260T probably benign Het
Fbxw10 C T 11: 62,867,513 probably benign Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gm14085 T C 2: 122,514,414 L167P possibly damaging Het
Gm5499 T C 17: 87,078,886 noncoding transcript Het
Gm9913 A G 2: 125,506,539 probably benign Het
Herc2 A G 7: 56,137,243 N1612S probably benign Het
Ifnar2 T C 16: 91,386,001 S53P possibly damaging Het
Inpp5j T A 11: 3,503,124 probably null Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Med28 A G 5: 45,522,478 T68A possibly damaging Het
Mfsd14a T C 3: 116,647,917 probably benign Het
Mnt G C 11: 74,843,110 probably benign Het
Mto1 A G 9: 78,458,028 Y413C probably damaging Het
Myo7b T C 18: 31,967,184 D1599G probably benign Het
Myoz1 T C 14: 20,653,617 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Npr2 T A 4: 43,640,182 Y306N probably damaging Het
Nrxn3 T G 12: 89,260,416 C274G probably damaging Het
Olfr204 A T 16: 59,314,726 M227K probably benign Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Phldb2 T C 16: 45,825,010 T403A probably benign Het
Plaa T C 4: 94,569,805 I643V probably benign Het
Stau1 T C 2: 166,955,016 I154V possibly damaging Het
Ugcg T G 4: 59,213,922 V168G probably damaging Het
Vmn2r2 T C 3: 64,134,632 I221V probably benign Het
Wdr93 T C 7: 79,752,493 I180T possibly damaging Het
Whamm G C 7: 81,571,784 G155R probably damaging Het
Wnt5a T A 14: 28,513,183 Y41* probably null Het
Other mutations in Meis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Meis1 APN 11 18881811 missense probably benign 0.25
IGL02156:Meis1 APN 11 19011292 missense probably benign 0.03
IGL02376:Meis1 APN 11 18881752 missense probably benign 0.06
R0505:Meis1 UTSW 11 19011360 missense probably damaging 0.99
R0833:Meis1 UTSW 11 18881767 missense possibly damaging 0.91
R1477:Meis1 UTSW 11 18881665 nonsense probably null
R1512:Meis1 UTSW 11 18881682 missense probably damaging 0.97
R1643:Meis1 UTSW 11 19016278 missense probably benign 0.00
R1717:Meis1 UTSW 11 19010608 intron probably benign
R2117:Meis1 UTSW 11 18881679 missense probably damaging 1.00
R2342:Meis1 UTSW 11 18881647 missense probably damaging 1.00
R2426:Meis1 UTSW 11 18988356 missense possibly damaging 0.64
R3076:Meis1 UTSW 11 19011254 missense probably benign 0.01
R4368:Meis1 UTSW 11 19010656 intron probably benign
R4915:Meis1 UTSW 11 19009222 intron probably benign
R4916:Meis1 UTSW 11 18881776 missense possibly damaging 0.91
R4917:Meis1 UTSW 11 19009222 intron probably benign
R4918:Meis1 UTSW 11 19009222 intron probably benign
R4948:Meis1 UTSW 11 19016308 missense probably benign 0.00
R5093:Meis1 UTSW 11 18881785 missense probably benign 0.13
R5506:Meis1 UTSW 11 18941747 missense possibly damaging 0.52
R5507:Meis1 UTSW 11 19016168 missense probably benign 0.27
R5521:Meis1 UTSW 11 18988260 splice site probably benign
R5673:Meis1 UTSW 11 19012812 missense probably damaging 1.00
R5813:Meis1 UTSW 11 19016229 missense probably benign 0.11
R6347:Meis1 UTSW 11 18905631 intron probably null
R6354:Meis1 UTSW 11 19016184 missense possibly damaging 0.89
R6383:Meis1 UTSW 11 18941741 missense probably benign
R6624:Meis1 UTSW 11 19016215 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTAGAGCCAGCCTTAATGAAGC -3'
(R):5'- GGACTGCACTTGTCAATGTCG -3'

Sequencing Primer
(F):5'- GCCAGCCTTAATGAAGCAATAATAG -3'
(R):5'- ACTGCACTTGTCAATGTCGTTTATG -3'
Posted On2015-02-05