Incidental Mutation 'R3079:Padi2'
ID265324
Institutional Source Beutler Lab
Gene Symbol Padi2
Ensembl Gene ENSMUSG00000028927
Gene Namepeptidyl arginine deiminase, type II
SynonymsPAD type II, Pdi, Pdi2
MMRRC Submission 040569-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3079 (G1)
Quality Score212
Status Not validated
Chromosome4
Chromosomal Location140906344-140952586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140949878 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 659 (V659A)
Ref Sequence ENSEMBL: ENSMUSP00000030765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030765]
Predicted Effect probably damaging
Transcript: ENSMUST00000030765
AA Change: V659A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030765
Gene: ENSMUSG00000028927
AA Change: V659A

DomainStartEndE-ValueType
Pfam:PAD_N 9 122 1.7e-36 PFAM
Pfam:PAD_M 124 282 4e-71 PFAM
Pfam:PAD 292 670 3.8e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140501
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type II enzyme is the most widely expressed family member. Known substrates for this enzyme include myelin basic protein in the central nervous system and vimentin in skeletal muscle and macrophages. This enzyme is thought to play a role in the onset and progression of neurodegenerative human disorders, including Alzheimer disease and multiple sclerosis, and it has also been implicated in glaucoma pathogenesis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired ATP- or calcium ionophore ionomycin-induced citrullination of mast cells or of proteins following induction of EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A T 15: 102,340,444 L168H probably damaging Het
Abca15 T C 7: 120,385,169 W1158R probably damaging Het
AI481877 G T 4: 59,047,848 T1257N possibly damaging Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Aqp11 A T 7: 97,737,588 C134S probably benign Het
Arhgap35 A G 7: 16,562,576 Y855H probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Cit A G 5: 115,925,486 D462G probably damaging Het
Col6a6 T C 9: 105,754,223 R1494G probably benign Het
Edc4 T C 8: 105,885,118 S109P possibly damaging Het
Elp4 T C 2: 105,809,445 K130E possibly damaging Het
Gemin5 A T 11: 58,145,519 V666E probably damaging Het
Gm13128 T G 4: 144,331,528 L235R probably damaging Het
Hba-x A G 11: 32,277,616 D62G probably damaging Het
Hnrnpul1 A T 7: 25,733,115 Y474* probably null Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Mrc2 T C 11: 105,336,713 S591P probably damaging Het
Msh5 T C 17: 35,046,232 E48G probably benign Het
Mybpc2 T C 7: 44,506,081 D916G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nlrp1b T C 11: 71,217,968 R236G probably benign Het
Obsl1 G T 1: 75,490,823 R1436S probably damaging Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr576 C T 7: 102,973,047 probably null Het
Pnpla6 T G 8: 3,541,512 S1169A probably benign Het
Pqlc2 G T 4: 139,306,518 A30D probably damaging Het
Prl6a1 A G 13: 27,319,000 D193G possibly damaging Het
Rce1 G T 19: 4,624,722 C138* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint2 A G 4: 112,639,673 T259A probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Slfn1 T C 11: 83,121,160 V34A probably benign Het
Syt4 A G 18: 31,441,685 V293A probably benign Het
Trh T C 6: 92,242,570 E255G possibly damaging Het
Ube4a G T 9: 44,960,073 N9K probably damaging Het
Uck1 A T 2: 32,258,077 probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Wbp2 C T 11: 116,079,708 probably null Het
Zdbf2 A G 1: 63,307,477 I1672V probably benign Het
Other mutations in Padi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Padi2 APN 4 140917637 missense probably benign 0.27
IGL01374:Padi2 APN 4 140933185 missense probably damaging 1.00
IGL01608:Padi2 APN 4 140932230 missense probably damaging 1.00
IGL02085:Padi2 APN 4 140927157 nonsense probably null
IGL02593:Padi2 APN 4 140949842 missense probably damaging 1.00
IGL02668:Padi2 APN 4 140949880 missense probably benign 0.02
IGL03341:Padi2 APN 4 140927113 missense probably benign 0.06
R0116:Padi2 UTSW 4 140926239 missense probably benign 0.00
R2045:Padi2 UTSW 4 140937930 missense probably damaging 1.00
R2079:Padi2 UTSW 4 140933196 missense probably damaging 1.00
R3022:Padi2 UTSW 4 140937988 missense possibly damaging 0.79
R3780:Padi2 UTSW 4 140917737 missense probably benign 0.00
R4250:Padi2 UTSW 4 140906546 missense probably damaging 0.97
R4276:Padi2 UTSW 4 140936548 missense possibly damaging 0.93
R4647:Padi2 UTSW 4 140944446 missense probably damaging 1.00
R5058:Padi2 UTSW 4 140932121 missense probably benign 0.00
R5452:Padi2 UTSW 4 140932071 missense probably benign 0.26
R5471:Padi2 UTSW 4 140933208 missense possibly damaging 0.90
R5489:Padi2 UTSW 4 140944488 missense probably damaging 0.99
R5519:Padi2 UTSW 4 140949222 missense probably damaging 1.00
R5666:Padi2 UTSW 4 140949231 missense possibly damaging 0.76
R5793:Padi2 UTSW 4 140933190 missense probably benign 0.04
R5913:Padi2 UTSW 4 140917641 missense probably benign 0.00
R5929:Padi2 UTSW 4 140944537 critical splice donor site probably null
R5933:Padi2 UTSW 4 140917641 missense probably benign 0.00
R6478:Padi2 UTSW 4 140917637 missense probably benign 0.00
R6809:Padi2 UTSW 4 140946766 splice site probably null
R7075:Padi2 UTSW 4 140933217 missense probably damaging 0.96
R7313:Padi2 UTSW 4 140932768 missense probably damaging 0.99
R7380:Padi2 UTSW 4 140917686 nonsense probably null
R7391:Padi2 UTSW 4 140937955 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGTGGCTGCTCCCTAAAC -3'
(R):5'- ACACTGAGGTCCTTCTCCAG -3'

Sequencing Primer
(F):5'- TCCCAGGTGAACATGATCGTG -3'
(R):5'- TTCTCCAGGGGACAGCAAG -3'
Posted On2015-02-05