Incidental Mutation 'R3080:Ltbp3'
ID265404
Institutional Source Beutler Lab
Gene Symbol Ltbp3
Ensembl Gene ENSMUSG00000024940
Gene Namelatent transforming growth factor beta binding protein 3
SynonymsLtbp2
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R3080 (G1)
Quality Score217
Status Not validated
Chromosome19
Chromosomal Location5740904-5758532 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTA to GTATA at 5756888 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025890] [ENSMUST00000081496]
Predicted Effect probably benign
Transcript: ENSMUST00000025890
SMART Domains Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 30 254 3.3e-11 PFAM
Pfam:Pkinase 31 252 2e-14 PFAM
SCOP:d1gw5a_ 350 536 1e-18 SMART
low complexity region 556 577 N/A INTRINSIC
low complexity region 608 620 N/A INTRINSIC
coiled coil region 759 795 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081496
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Tro G A X: 150,655,202 T153I probably benign Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Ltbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ltbp3 APN 19 5756016 missense probably damaging 0.99
IGL00978:Ltbp3 APN 19 5754019 missense probably benign 0.26
IGL01517:Ltbp3 APN 19 5757732 missense possibly damaging 0.57
IGL01529:Ltbp3 APN 19 5747839 missense probably benign 0.06
IGL03119:Ltbp3 APN 19 5757443 missense probably damaging 0.98
csp UTSW 19 5747688 missense probably damaging 1.00
lilia UTSW 19 5747857 critical splice donor site probably null
rapunzel UTSW 19 5753942 nonsense probably null
PIT4305001:Ltbp3 UTSW 19 5752067 missense probably damaging 0.99
PIT4453001:Ltbp3 UTSW 19 5757794 missense probably damaging 0.97
PIT4480001:Ltbp3 UTSW 19 5751226 missense possibly damaging 0.73
R0211:Ltbp3 UTSW 19 5752143 critical splice donor site probably null
R0718:Ltbp3 UTSW 19 5746748 splice site probably benign
R1103:Ltbp3 UTSW 19 5747411 critical splice acceptor site probably null
R1103:Ltbp3 UTSW 19 5747412 critical splice acceptor site probably null
R1299:Ltbp3 UTSW 19 5745428 splice site probably benign
R1510:Ltbp3 UTSW 19 5748887 missense probably benign 0.02
R1616:Ltbp3 UTSW 19 5746967 missense probably damaging 1.00
R1682:Ltbp3 UTSW 19 5751754 missense probably benign 0.02
R1752:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R1806:Ltbp3 UTSW 19 5753942 nonsense probably null
R1866:Ltbp3 UTSW 19 5747849 missense probably benign 0.43
R1981:Ltbp3 UTSW 19 5758079 missense probably benign 0.15
R2211:Ltbp3 UTSW 19 5753962 missense possibly damaging 0.79
R2239:Ltbp3 UTSW 19 5751523 nonsense probably null
R2261:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2263:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2380:Ltbp3 UTSW 19 5751523 nonsense probably null
R2412:Ltbp3 UTSW 19 5746645 missense probably benign 0.08
R2446:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2449:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3056:Ltbp3 UTSW 19 5751406 missense probably benign 0.11
R3863:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3864:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3951:Ltbp3 UTSW 19 5756001 missense probably damaging 1.00
R3961:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3962:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3963:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3972:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4028:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4031:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4041:Ltbp3 UTSW 19 5751871 missense possibly damaging 0.95
R4060:Ltbp3 UTSW 19 5742320 missense probably benign 0.41
R4296:Ltbp3 UTSW 19 5756582 critical splice acceptor site probably null
R4525:Ltbp3 UTSW 19 5746359 missense probably benign 0.09
R4660:Ltbp3 UTSW 19 5748786 intron probably null
R4794:Ltbp3 UTSW 19 5756679 missense probably damaging 1.00
R4980:Ltbp3 UTSW 19 5753927 critical splice acceptor site probably null
R5071:Ltbp3 UTSW 19 5756823 missense probably damaging 1.00
R5702:Ltbp3 UTSW 19 5747821 missense probably benign
R5771:Ltbp3 UTSW 19 5747544 missense probably damaging 1.00
R6021:Ltbp3 UTSW 19 5753680 missense probably benign 0.00
R6053:Ltbp3 UTSW 19 5752094 missense probably damaging 0.98
R6321:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R6339:Ltbp3 UTSW 19 5747477 missense probably damaging 1.00
R6371:Ltbp3 UTSW 19 5745772 splice site probably null
R6709:Ltbp3 UTSW 19 5747857 critical splice donor site probably null
X0066:Ltbp3 UTSW 19 5751277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTACTACGATGGCAACCTGCTG -3'
(R):5'- GAACTCAAAATCGGCCCAGG -3'

Sequencing Primer
(F):5'- ATGGCAACCTGCTGGAGTG -3'
(R):5'- ACAATTCAGCATGGGCTC -3'
Posted On2015-02-05