Incidental Mutation 'R3081:Rusc1'
ID265414
Institutional Source Beutler Lab
Gene Symbol Rusc1
Ensembl Gene ENSMUSG00000041263
Gene NameRUN and SH3 domain containing 1
Synonyms
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89083981-89093311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89091723 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 251 (S251P)
Ref Sequence ENSEMBL: ENSMUSP00000088447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052539] [ENSMUST00000081848] [ENSMUST00000090929] [ENSMUST00000166687] [ENSMUST00000196043] [ENSMUST00000196223] [ENSMUST00000196254] [ENSMUST00000196709] [ENSMUST00000196921] [ENSMUST00000199668] [ENSMUST00000200659]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052539
AA Change: S251P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056640
Gene: ENSMUSG00000041263
AA Change: S251P

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
RUN 589 657 2.75e-16 SMART
low complexity region 669 683 N/A INTRINSIC
low complexity region 702 714 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
SH3 838 893 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081848
SMART Domains Protein: ENSMUSP00000080531
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 47 313 2e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090929
AA Change: S251P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088447
Gene: ENSMUSG00000041263
AA Change: S251P

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
internal_repeat_1 195 244 5.11e-5 PROSPERO
internal_repeat_1 247 292 5.11e-5 PROSPERO
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 463 479 N/A INTRINSIC
low complexity region 522 543 N/A INTRINSIC
low complexity region 546 584 N/A INTRINSIC
low complexity region 714 725 N/A INTRINSIC
RUN 726 794 2.75e-16 SMART
low complexity region 806 820 N/A INTRINSIC
low complexity region 839 851 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
SH3 975 1030 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166687
SMART Domains Protein: ENSMUSP00000130477
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
low complexity region 115 126 N/A INTRINSIC
RUN 127 195 2.75e-16 SMART
low complexity region 207 221 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
SH3 376 431 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196043
SMART Domains Protein: ENSMUSP00000142622
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
PDB:4GIW|B 8 79 5e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196223
SMART Domains Protein: ENSMUSP00000143662
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
Pfam:RUN 61 166 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196254
SMART Domains Protein: ENSMUSP00000142669
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 1 238 3.6e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196709
SMART Domains Protein: ENSMUSP00000142770
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 316 8.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196921
SMART Domains Protein: ENSMUSP00000142704
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 226 7.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198506
Predicted Effect probably benign
Transcript: ENSMUST00000199668
SMART Domains Protein: ENSMUSP00000142393
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 121 3.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200433
Predicted Effect probably benign
Transcript: ENSMUST00000200659
SMART Domains Protein: ENSMUSP00000142694
Gene: ENSMUSG00000105204

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 334 3.2e-55 PFAM
low complexity region 548 559 N/A INTRINSIC
RUN 560 628 9.3e-19 SMART
low complexity region 640 654 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 741 N/A INTRINSIC
SH3 809 862 2.8e-10 SMART
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Rusc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Rusc1 APN 3 89092421 missense probably damaging 0.99
IGL02795:Rusc1 APN 3 89091950 missense probably damaging 1.00
IGL03174:Rusc1 APN 3 89091770 missense probably damaging 1.00
R0422:Rusc1 UTSW 3 89086825 missense probably benign 0.01
R1711:Rusc1 UTSW 3 89089293 missense probably damaging 1.00
R1846:Rusc1 UTSW 3 89092145 missense probably damaging 1.00
R2060:Rusc1 UTSW 3 89087848 missense possibly damaging 0.86
R2114:Rusc1 UTSW 3 89091707 missense probably benign
R2209:Rusc1 UTSW 3 89088821 missense probably damaging 1.00
R3155:Rusc1 UTSW 3 89091731 missense probably benign 0.03
R3156:Rusc1 UTSW 3 89091731 missense probably benign 0.03
R4499:Rusc1 UTSW 3 89092308 missense probably benign 0.02
R4678:Rusc1 UTSW 3 89089720 missense probably damaging 1.00
R4725:Rusc1 UTSW 3 89091429 missense possibly damaging 0.83
R4762:Rusc1 UTSW 3 89091642 missense probably benign
R4890:Rusc1 UTSW 3 89088270 critical splice acceptor site probably null
R5176:Rusc1 UTSW 3 89089082 missense probably damaging 1.00
R5783:Rusc1 UTSW 3 89088145 missense probably damaging 1.00
R5910:Rusc1 UTSW 3 89091720 missense probably benign 0.05
R6189:Rusc1 UTSW 3 89089012 missense probably damaging 1.00
R6190:Rusc1 UTSW 3 89091881 missense probably benign
R6227:Rusc1 UTSW 3 89091741 missense probably benign 0.06
R7087:Rusc1 UTSW 3 89089492 missense probably damaging 0.96
R7184:Rusc1 UTSW 3 89091887 missense possibly damaging 0.61
R7237:Rusc1 UTSW 3 89091498 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CTCATGGAAGGACGTGATTGTC -3'
(R):5'- ACCTGGACTCGAACTGCAAC -3'

Sequencing Primer
(F):5'- ACGTGATTGTCCGATGGGGC -3'
(R):5'- TCGAACTGCAACGCCCTG -3'
Posted On2015-02-05