Incidental Mutation 'R3081:Asl'
ID265418
Institutional Source Beutler Lab
Gene Symbol Asl
Ensembl Gene ENSMUSG00000025533
Gene Nameargininosuccinate lyase
Synonyms
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location130011258-130029247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130013404 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 277 (Y277C)
Ref Sequence ENSEMBL: ENSMUSP00000124274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159619] [ENSMUST00000160129] [ENSMUST00000161094] [ENSMUST00000161640]
Predicted Effect unknown
Transcript: ENSMUST00000159096
AA Change: Y79C
SMART Domains Protein: ENSMUSP00000125143
Gene: ENSMUSG00000025533
AA Change: Y79C

DomainStartEndE-ValueType
Pfam:Lyase_1 1 108 3.7e-32 PFAM
Pfam:ASL_C2 171 238 1.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159619
AA Change: Y277C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123799
Gene: ENSMUSG00000025533
AA Change: Y277C

DomainStartEndE-ValueType
Pfam:Lyase_1 11 305 2e-107 PFAM
Pfam:ASL_C2 367 436 1.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160129
AA Change: Y277C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124579
Gene: ENSMUSG00000025533
AA Change: Y277C

DomainStartEndE-ValueType
Pfam:Lyase_1 11 305 1.8e-107 PFAM
Pfam:ASL_C2 368 435 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160557
Predicted Effect probably damaging
Transcript: ENSMUST00000161094
AA Change: Y277C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124274
Gene: ENSMUSG00000025533
AA Change: Y277C

DomainStartEndE-ValueType
Pfam:Lyase_1 11 305 2e-107 PFAM
Pfam:ASL_C2 367 436 1.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161640
SMART Domains Protein: ENSMUSP00000124487
Gene: ENSMUSG00000025533

DomainStartEndE-ValueType
Pfam:Lyase_1 11 262 7.2e-87 PFAM
Meta Mutation Damage Score 0.558 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lyase 1 family. The encoded protein forms a cytosolic homotetramer and primarily catalyzes the reversible hydrolytic cleavage of argininosuccinate into arginine and fumarate, an essential step in the liver in detoxifying ammonia via the urea cycle. Mutations in this gene result in the autosomal recessive disorder argininosuccinic aciduria, or argininosuccinic acid lyase deficiency. A nontranscribed pseudogene is also located on the long arm of chromosome 22. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene fed well initially but then stopped feeding and became inactive before dying within 48 hours of birth. Arginine metabolism is disrupted leading to abnormal circulating amino acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Asl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Asl APN 5 130019804 missense probably damaging 0.96
IGL01881:Asl APN 5 130018538 unclassified probably benign
IGL02055:Asl APN 5 130013050 missense possibly damaging 0.85
IGL02087:Asl APN 5 130011601 nonsense probably null
IGL02309:Asl APN 5 130019781 missense probably damaging 1.00
IGL03343:Asl APN 5 130012067 missense probably damaging 1.00
R2939:Asl UTSW 5 130013404 missense probably damaging 1.00
R4005:Asl UTSW 5 130018832 critical splice donor site probably null
R4611:Asl UTSW 5 130018316 missense probably damaging 1.00
R4883:Asl UTSW 5 130013961 critical splice donor site probably null
R5278:Asl UTSW 5 130018831 critical splice donor site probably null
R6176:Asl UTSW 5 130018879 missense probably benign
R6198:Asl UTSW 5 130018916 missense probably benign 0.00
R6878:Asl UTSW 5 130024292 critical splice donor site probably null
R7132:Asl UTSW 5 130014702 missense possibly damaging 0.57
R7146:Asl UTSW 5 130024449 unclassified probably benign
X0065:Asl UTSW 5 130013413 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTTCTGGGGCATCAAGCTG -3'
(R):5'- GAGAGACTTTGTGGGTAAGACC -3'

Sequencing Primer
(F):5'- ATCAAGCTGCTTCCGGTG -3'
(R):5'- AATTTGTGACCAGCCTGAGC -3'
Posted On2015-02-05