Incidental Mutation 'R3081:Ssc4d'
ID265419
Institutional Source Beutler Lab
Gene Symbol Ssc4d
Ensembl Gene ENSMUSG00000029699
Gene Namescavenger receptor cysteine rich family, 4 domains
SynonymsC330016E03Rik, Srcrb4d
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R3081 (G1)
Quality Score224
Status Validated
Chromosome5
Chromosomal Location135960211-135974531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135965724 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 51 (T51A)
Ref Sequence ENSEMBL: ENSMUSP00000122958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054895] [ENSMUST00000111150] [ENSMUST00000111152] [ENSMUST00000111153] [ENSMUST00000153823] [ENSMUST00000154181]
Predicted Effect probably benign
Transcript: ENSMUST00000054895
SMART Domains Protein: ENSMUSP00000050439
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 32 132 1.99e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111150
SMART Domains Protein: ENSMUSP00000106780
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 6 106 1.99e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111152
AA Change: T250A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106782
Gene: ENSMUSG00000029699
AA Change: T250A

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
SR 200 300 6.78e-54 SMART
low complexity region 301 315 N/A INTRINSIC
SR 355 455 2.04e-48 SMART
SR 484 584 1.99e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111153
AA Change: T250A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106783
Gene: ENSMUSG00000029699
AA Change: T250A

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
SR 200 300 6.78e-54 SMART
low complexity region 301 315 N/A INTRINSIC
SR 355 455 2.04e-48 SMART
SR 484 584 1.99e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153823
AA Change: T51A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122958
Gene: ENSMUSG00000029699
AA Change: T51A

DomainStartEndE-ValueType
SR 1 101 6.78e-54 SMART
low complexity region 102 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154181
SMART Domains Protein: ENSMUSP00000123008
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154696
SMART Domains Protein: ENSMUSP00000117071
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 2 61 5.24e-5 SMART
low complexity region 88 102 N/A INTRINSIC
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scavenger receptor cysteine-rich (SRCR) superfamily is an ancient and highly conserved group of cell surface and/or secreted proteins, some of which are involved in the development of the immune system and the regulation of both innate and adaptive immune responses. Group B SRCR domains usually contain 8 regularly spaced cysteines that give rise to a well-defined intradomain disulfide-bond pattern.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Ssc4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Ssc4d APN 5 135967963 missense probably damaging 1.00
IGL02585:Ssc4d APN 5 135970338 missense possibly damaging 0.74
IGL02821:Ssc4d APN 5 135966069 splice site probably benign
IGL03343:Ssc4d APN 5 135961174 nonsense probably null
R2051:Ssc4d UTSW 5 135970264 missense probably benign 0.00
R2069:Ssc4d UTSW 5 135970317 missense possibly damaging 0.50
R2508:Ssc4d UTSW 5 135965607 missense probably damaging 1.00
R2901:Ssc4d UTSW 5 135964663 missense possibly damaging 0.57
R2902:Ssc4d UTSW 5 135964663 missense possibly damaging 0.57
R2939:Ssc4d UTSW 5 135965724 missense possibly damaging 0.61
R4038:Ssc4d UTSW 5 135970316 missense possibly damaging 0.50
R4181:Ssc4d UTSW 5 135961924 missense possibly damaging 0.85
R4590:Ssc4d UTSW 5 135964684 missense probably benign 0.00
R4771:Ssc4d UTSW 5 135970220 missense probably damaging 1.00
R5411:Ssc4d UTSW 5 135963400 missense probably benign 0.40
R5583:Ssc4d UTSW 5 135970196 missense probably damaging 0.99
R5662:Ssc4d UTSW 5 135960894 makesense probably null
R5681:Ssc4d UTSW 5 135970220 missense probably damaging 1.00
R6357:Ssc4d UTSW 5 135966096 missense probably benign 0.00
R6962:Ssc4d UTSW 5 135962921 critical splice donor site probably null
R7258:Ssc4d UTSW 5 135963087 missense probably damaging 1.00
R7274:Ssc4d UTSW 5 135967956 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGATAGCCAACCCCTTTTCC -3'
(R):5'- ATCCACCATCACCAGGTGAG -3'

Sequencing Primer
(F):5'- TCCTTCCGAAGACCCCG -3'
(R):5'- CATCACCAGGTGAGGGCAGTG -3'
Posted On2015-02-05