Incidental Mutation 'R3081:Olfr870'
ID265426
Institutional Source Beutler Lab
Gene Symbol Olfr870
Ensembl Gene ENSMUSG00000066899
Gene Nameolfactory receptor 870
SynonymsGA_x6K02T2PVTD-13912679-13911744, MOR141-1
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20168533-20174057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20170765 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 269 (G269W)
Ref Sequence ENSEMBL: ENSMUSP00000150084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086476] [ENSMUST00000215984]
Predicted Effect probably benign
Transcript: ENSMUST00000086476
AA Change: G269W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091405
Gene: ENSMUSG00000066899
AA Change: G269W

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 1.8e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.8e-7 PFAM
Pfam:7tm_1 41 290 3.9e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157618
Predicted Effect probably benign
Transcript: ENSMUST00000215984
AA Change: G269W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Olfr870
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr870 APN 9 20171530 missense probably damaging 1.00
IGL01809:Olfr870 APN 9 20171295 missense probably damaging 1.00
IGL02130:Olfr870 APN 9 20171358 missense probably damaging 0.96
IGL03062:Olfr870 APN 9 20171167 missense probably damaging 1.00
IGL03133:Olfr870 APN 9 20170713 missense probably damaging 1.00
R0110:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R0350:Olfr870 UTSW 9 20170736 nonsense probably null
R0417:Olfr870 UTSW 9 20171214 missense probably damaging 1.00
R0450:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R0469:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R1169:Olfr870 UTSW 9 20171058 missense probably benign 0.04
R1728:Olfr870 UTSW 9 20170913 nonsense probably null
R1729:Olfr870 UTSW 9 20170913 nonsense probably null
R1776:Olfr870 UTSW 9 20170809 missense probably benign 0.16
R1784:Olfr870 UTSW 9 20170913 nonsense probably null
R1914:Olfr870 UTSW 9 20171028 missense probably benign 0.22
R1915:Olfr870 UTSW 9 20171028 missense probably benign 0.22
R1929:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R1936:Olfr870 UTSW 9 20171181 missense probably damaging 1.00
R2066:Olfr870 UTSW 9 20171554 missense probably benign 0.01
R2137:Olfr870 UTSW 9 20171167 missense probably damaging 1.00
R2221:Olfr870 UTSW 9 20171092 missense possibly damaging 0.86
R2270:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2271:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2272:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2509:Olfr870 UTSW 9 20171229 missense probably damaging 1.00
R2939:Olfr870 UTSW 9 20170765 missense probably benign
R2940:Olfr870 UTSW 9 20170765 missense probably benign
R4579:Olfr870 UTSW 9 20171114 missense probably damaging 1.00
R4667:Olfr870 UTSW 9 20171098 missense probably benign 0.04
R5681:Olfr870 UTSW 9 20170795 missense probably damaging 1.00
R5686:Olfr870 UTSW 9 20170969 missense possibly damaging 0.75
R5857:Olfr870 UTSW 9 20171239 missense probably damaging 1.00
R6561:Olfr870 UTSW 9 20170777 missense probably benign 0.01
R6842:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R6987:Olfr870 UTSW 9 20170834 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCATGCTGAAATGTAGACTTTG -3'
(R):5'- ATGGGTCCTTGGCTTCATCC -3'

Sequencing Primer
(F):5'- CATGCTGAAATGTAGACTTTGTACTG -3'
(R):5'- GGCTTCATCCCTTTCTCAGG -3'
Posted On2015-02-05