Incidental Mutation 'R3081:Olfr954'
ID265430
Institutional Source Beutler Lab
Gene Symbol Olfr954
Ensembl Gene ENSMUSG00000094745
Gene Nameolfactory receptor 954
SynonymsGA_x6K02T2PVTD-33158015-33158950, MOR171-53, MOR171-42
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3081 (G1)
Quality Score199
Status Validated
Chromosome9
Chromosomal Location39456701-39464625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39461930 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 166 (M166I)
Ref Sequence ENSEMBL: ENSMUSP00000079205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080329] [ENSMUST00000214818]
Predicted Effect probably benign
Transcript: ENSMUST00000080329
AA Change: M166I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000079205
Gene: ENSMUSG00000094745
AA Change: M166I

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 38 264 3e-5 PFAM
Pfam:7tm_1 44 293 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214818
AA Change: M163I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Olfr954
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02704:Olfr954 APN 9 39462283 missense probably damaging 0.98
IGL02793:Olfr954 APN 9 39461506 missense probably benign 0.09
IGL02964:Olfr954 APN 9 39461781 missense possibly damaging 0.88
IGL02979:Olfr954 APN 9 39461523 missense probably benign 0.02
R0041:Olfr954 UTSW 9 39461476 missense probably benign 0.34
R0153:Olfr954 UTSW 9 39461671 missense probably damaging 0.99
R0269:Olfr954 UTSW 9 39461794 missense probably damaging 1.00
R0426:Olfr954 UTSW 9 39461593 missense probably damaging 1.00
R0731:Olfr954 UTSW 9 39461532 missense probably damaging 1.00
R1800:Olfr954 UTSW 9 39462114 missense probably damaging 1.00
R2340:Olfr954 UTSW 9 39461809 missense probably damaging 1.00
R2901:Olfr954 UTSW 9 39461938 missense probably damaging 0.97
R2912:Olfr954 UTSW 9 39462216 missense probably damaging 1.00
R2939:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R2940:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3765:Olfr954 UTSW 9 39461624 nonsense probably null
R4450:Olfr954 UTSW 9 39462032 missense probably benign 0.00
R4515:Olfr954 UTSW 9 39462231 nonsense probably null
R4786:Olfr954 UTSW 9 39461841 missense probably benign 0.16
R4961:Olfr954 UTSW 9 39461887 missense probably damaging 1.00
R5219:Olfr954 UTSW 9 39462267 missense probably benign 0.09
R5602:Olfr954 UTSW 9 39462030 missense probably benign 0.00
R5887:Olfr954 UTSW 9 39461491 missense probably damaging 1.00
R5950:Olfr954 UTSW 9 39462337 missense probably benign 0.01
R6943:Olfr954 UTSW 9 39461863 missense probably benign 0.05
X0060:Olfr954 UTSW 9 39462274 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCTTGGCTCAGCTCTAC -3'
(R):5'- AGCTAATGCGGAGGATGCTG -3'

Sequencing Primer
(F):5'- AGCTCTACTTTGCCATCATTTTTGG -3'
(R):5'- TAATGCGGAGGATGCTGGAAATAATG -3'
Posted On2015-02-05