Incidental Mutation 'R3081:Dixdc1'
ID265432
Institutional Source Beutler Lab
Gene Symbol Dixdc1
Ensembl Gene ENSMUSG00000032064
Gene NameDIX domain containing 1
Synonyms4930563F16Rik, Ccd1
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50662752-50739517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50710959 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 25 (A25V)
Ref Sequence ENSEMBL: ENSMUSP00000113907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034566] [ENSMUST00000117093] [ENSMUST00000117646] [ENSMUST00000118707] [ENSMUST00000121634]
Predicted Effect probably damaging
Transcript: ENSMUST00000034566
AA Change: A25V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034566
Gene: ENSMUSG00000032064
AA Change: A25V

DomainStartEndE-ValueType
CH 22 151 5.48e-8 SMART
low complexity region 178 190 N/A INTRINSIC
low complexity region 237 254 N/A INTRINSIC
coiled coil region 306 338 N/A INTRINSIC
coiled coil region 359 492 N/A INTRINSIC
Pfam:DIX 627 706 1.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117093
AA Change: A24V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112654
Gene: ENSMUSG00000032064
AA Change: A24V

DomainStartEndE-ValueType
Pfam:CH 22 88 3.2e-9 PFAM
Pfam:CAMSAP_CH 30 62 1.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117646
AA Change: A25V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112431
Gene: ENSMUSG00000032064
AA Change: A25V

DomainStartEndE-ValueType
CH 22 125 1.25e-11 SMART
low complexity region 152 164 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
coiled coil region 280 312 N/A INTRINSIC
coiled coil region 333 466 N/A INTRINSIC
Pfam:DIX 600 682 5.1e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118707
AA Change: A25V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113907
Gene: ENSMUSG00000032064
AA Change: A25V

DomainStartEndE-ValueType
Pfam:CH 23 89 2.3e-9 PFAM
Pfam:CAMSAP_CH 31 63 8.1e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121634
AA Change: A24V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113089
Gene: ENSMUSG00000032064
AA Change: A24V

DomainStartEndE-ValueType
CH 21 150 5.48e-8 SMART
low complexity region 177 189 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
coiled coil region 305 337 N/A INTRINSIC
coiled coil region 358 491 N/A INTRINSIC
Pfam:DIX 625 707 5.3e-37 PFAM
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a positive regulator of the Wnt signaling pathway. The encoded protein is found associated with gamma tubulin at the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced spontaneous locomotor activity, abnormal behavior in the elevated plus maze, and deficits in startle reactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Dixdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dixdc1 APN 9 50667733 missense probably damaging 0.98
IGL01556:Dixdc1 APN 9 50706134 missense probably damaging 1.00
IGL01923:Dixdc1 APN 9 50695503 missense possibly damaging 0.87
IGL01933:Dixdc1 APN 9 50703258 nonsense probably null
IGL02074:Dixdc1 APN 9 50702017 missense probably benign 0.00
IGL02364:Dixdc1 APN 9 50682631 splice site probably benign
R0230:Dixdc1 UTSW 9 50695507 missense possibly damaging 0.80
R0401:Dixdc1 UTSW 9 50693674 missense possibly damaging 0.54
R0410:Dixdc1 UTSW 9 50684853 missense probably damaging 1.00
R1028:Dixdc1 UTSW 9 50703246 missense probably benign 0.02
R1083:Dixdc1 UTSW 9 50676993 intron probably benign
R1672:Dixdc1 UTSW 9 50689864 missense probably damaging 1.00
R1752:Dixdc1 UTSW 9 50682550 missense probably benign
R2213:Dixdc1 UTSW 9 50701945 missense probably benign 0.01
R2289:Dixdc1 UTSW 9 50683872 critical splice donor site probably null
R2939:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R2940:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R4982:Dixdc1 UTSW 9 50682602 missense possibly damaging 0.89
R5250:Dixdc1 UTSW 9 50683735 missense possibly damaging 0.88
R5581:Dixdc1 UTSW 9 50669480 missense probably damaging 1.00
R5914:Dixdc1 UTSW 9 50698588 intron probably benign
R6228:Dixdc1 UTSW 9 50703356 splice site probably null
R6346:Dixdc1 UTSW 9 50683953 missense probably damaging 1.00
R6370:Dixdc1 UTSW 9 50682223 intron probably null
R7036:Dixdc1 UTSW 9 50682564 missense probably benign 0.03
R7074:Dixdc1 UTSW 9 50689914 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GAACAACCTGCTTTGAAGGGC -3'
(R):5'- TGCGTGTCAACCTAAAGCTAG -3'

Sequencing Primer
(F):5'- CAACCTGCTTTGAAGGGCGAATG -3'
(R):5'- AAGCTAGGGATTTTGGAACATGCTC -3'
Posted On2015-02-05