Incidental Mutation 'R3081:Coro6'
ID265443
Institutional Source Beutler Lab
Gene Symbol Coro6
Ensembl Gene ENSMUSG00000020836
Gene Namecoronin 6
Synonymsclipin E
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77462411-77470484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77468912 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 336 (F336S)
Ref Sequence ENSEMBL: ENSMUSP00000104028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021190] [ENSMUST00000037593] [ENSMUST00000052515] [ENSMUST00000079770] [ENSMUST00000092892] [ENSMUST00000102493] [ENSMUST00000108391] [ENSMUST00000130255] [ENSMUST00000145934]
Predicted Effect probably damaging
Transcript: ENSMUST00000021190
AA Change: F336S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021190
Gene: ENSMUSG00000020836
AA Change: F336S

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037593
SMART Domains Protein: ENSMUSP00000073584
Gene: ENSMUSG00000037907

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 491 5.5e-111 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 552 580 N/A INTRINSIC
UIM 585 604 3.15e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000052515
AA Change: F296S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056862
Gene: ENSMUSG00000020836
AA Change: F296S

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 217 351 1.19e-91 SMART
low complexity region 374 389 N/A INTRINSIC
coiled coil region 390 424 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079770
AA Change: F296S

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078703
Gene: ENSMUSG00000020836
AA Change: F296S

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 217 351 1.19e-91 SMART
low complexity region 374 389 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092892
SMART Domains Protein: ENSMUSP00000090568
Gene: ENSMUSG00000037907

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 490 3.2e-110 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102493
AA Change: F336S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099551
Gene: ENSMUSG00000020836
AA Change: F336S

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000108391
AA Change: F336S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104028
Gene: ENSMUSG00000020836
AA Change: F336S

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127291
SMART Domains Protein: ENSMUSP00000118247
Gene: ENSMUSG00000037907

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 120 9.7e-31 PFAM
low complexity region 121 133 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143872
Predicted Effect probably benign
Transcript: ENSMUST00000145934
SMART Domains Protein: ENSMUSP00000119633
Gene: ENSMUSG00000037907

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 2 276 9.7e-90 PFAM
UIM 288 307 1.81e-1 SMART
Meta Mutation Damage Score 0.448 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Coro6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Coro6 APN 11 77468465 missense probably damaging 1.00
IGL01086:Coro6 APN 11 77466548 nonsense probably null
IGL03184:Coro6 APN 11 77463953 missense probably damaging 1.00
R0365:Coro6 UTSW 11 77464090 missense probably benign 0.28
R1712:Coro6 UTSW 11 77469467 missense probably benign 0.19
R1738:Coro6 UTSW 11 77469425 missense probably benign 0.02
R2900:Coro6 UTSW 11 77467813 missense probably benign
R3700:Coro6 UTSW 11 77467303 missense probably damaging 1.00
R4503:Coro6 UTSW 11 77469446 missense probably benign 0.31
R4740:Coro6 UTSW 11 77469199 missense possibly damaging 0.59
R4749:Coro6 UTSW 11 77469148 missense probably damaging 1.00
R5501:Coro6 UTSW 11 77467796 missense probably damaging 1.00
R5996:Coro6 UTSW 11 77466496 missense probably benign 0.02
R6590:Coro6 UTSW 11 77465780 missense probably benign 0.31
R6619:Coro6 UTSW 11 77466204 missense possibly damaging 0.85
R6690:Coro6 UTSW 11 77465780 missense probably benign 0.31
R7052:Coro6 UTSW 11 77466230 missense probably benign 0.16
R7207:Coro6 UTSW 11 77467263 missense possibly damaging 0.46
X0064:Coro6 UTSW 11 77468608 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCCCAGCATTGTCCTACTAGC -3'
(R):5'- AGCCACTCATCAGCTTCCAG -3'

Sequencing Primer
(F):5'- TAGCCTGACATTCCAACAGAGGTG -3'
(R):5'- ACTCATCAGCTTCCAGGGCAG -3'
Posted On2015-02-05