Incidental Mutation 'R3081:Evpl'
ID265448
Institutional Source Beutler Lab
Gene Symbol Evpl
Ensembl Gene ENSMUSG00000034282
Gene Nameenvoplakin
Synonyms210kDa protein
MMRRC Submission 040571-MU
Accession Numbers

Genbank: NM_025276; MGI: 107507

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3081 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116220559-116238077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116220852 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2004 (D2004G)
Ref Sequence ENSEMBL: ENSMUSP00000037850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037007] [ENSMUST00000174177]
Predicted Effect probably damaging
Transcript: ENSMUST00000037007
AA Change: D2004G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: D2004G

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Blast:SPEC 44 140 1e-16 BLAST
Blast:SPEC 140 226 4e-46 BLAST
SPEC 229 330 2.21e-6 SMART
Blast:SPEC 336 500 7e-68 BLAST
low complexity region 508 525 N/A INTRINSIC
Blast:SPEC 527 632 4e-41 BLAST
Blast:SPEC 635 746 5e-48 BLAST
Blast:SPEC 753 867 7e-49 BLAST
low complexity region 868 881 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
internal_repeat_2 1011 1030 6.54e-6 PROSPERO
internal_repeat_3 1012 1032 1.94e-5 PROSPERO
coiled coil region 1035 1077 N/A INTRINSIC
low complexity region 1131 1144 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
PLEC 1186 1227 1.48e2 SMART
low complexity region 1228 1242 N/A INTRINSIC
coiled coil region 1262 1366 N/A INTRINSIC
low complexity region 1398 1414 N/A INTRINSIC
internal_repeat_2 1457 1476 6.54e-6 PROSPERO
internal_repeat_3 1516 1536 1.94e-5 PROSPERO
low complexity region 1595 1617 N/A INTRINSIC
PLEC 1679 1714 9.19e-4 SMART
PLEC 1729 1764 4.53e1 SMART
low complexity region 1788 1800 N/A INTRINSIC
PLEC 1819 1856 1.41e-4 SMART
PLEC 1857 1894 5.4e-10 SMART
PLEC 1895 1932 2.7e-10 SMART
PLEC 1933 1970 1.21e-3 SMART
PLEC 1971 2008 1.16e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173567
Predicted Effect probably benign
Transcript: ENSMUST00000174177
SMART Domains Protein: ENSMUSP00000134251
Gene: ENSMUSG00000092300

DomainStartEndE-ValueType
S_TKc 4 285 4e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174248
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Als2 A G 1: 59,187,349 L932P probably damaging Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Evpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Evpl APN 11 116234505 missense probably benign 0.01
IGL00896:Evpl APN 11 116222584 nonsense probably null
IGL00941:Evpl APN 11 116227901 missense probably benign 0.06
IGL01443:Evpl APN 11 116222454 missense probably damaging 1.00
IGL01523:Evpl APN 11 116233444 missense probably damaging 1.00
IGL01957:Evpl APN 11 116223222 missense probably damaging 1.00
IGL02124:Evpl APN 11 116227015 missense probably benign 0.01
IGL02334:Evpl APN 11 116231024 nonsense probably null
IGL02457:Evpl APN 11 116230113 missense possibly damaging 0.87
IGL02502:Evpl APN 11 116222718 missense probably damaging 1.00
IGL02536:Evpl APN 11 116221209 missense probably damaging 1.00
IGL02948:Evpl APN 11 116221822 missense probably damaging 1.00
IGL03183:Evpl APN 11 116221612 missense probably damaging 0.98
IGL03405:Evpl APN 11 116227927 missense possibly damaging 0.89
A4554:Evpl UTSW 11 116220834 missense probably damaging 1.00
PIT4449001:Evpl UTSW 11 116233399 missense possibly damaging 0.87
R0082:Evpl UTSW 11 116235003 missense probably damaging 1.00
R0108:Evpl UTSW 11 116220876 missense probably damaging 1.00
R0514:Evpl UTSW 11 116223291 missense probably damaging 0.99
R0581:Evpl UTSW 11 116229490 missense probably benign 0.02
R0727:Evpl UTSW 11 116232485 missense probably damaging 1.00
R0791:Evpl UTSW 11 116227723 missense probably damaging 1.00
R0792:Evpl UTSW 11 116227723 missense probably damaging 1.00
R1079:Evpl UTSW 11 116230068 missense possibly damaging 0.48
R1514:Evpl UTSW 11 116223835 missense probably benign
R1699:Evpl UTSW 11 116227588 missense probably damaging 1.00
R1717:Evpl UTSW 11 116225492 missense probably benign 0.06
R1775:Evpl UTSW 11 116223660 missense possibly damaging 0.66
R1886:Evpl UTSW 11 116227576 missense probably damaging 0.97
R1903:Evpl UTSW 11 116227028 missense probably damaging 1.00
R2081:Evpl UTSW 11 116234266 missense probably damaging 1.00
R2137:Evpl UTSW 11 116221839 missense probably damaging 0.99
R2571:Evpl UTSW 11 116237969 missense unknown
R4097:Evpl UTSW 11 116223177 missense possibly damaging 0.89
R4541:Evpl UTSW 11 116232644 missense probably benign 0.01
R4562:Evpl UTSW 11 116233399 missense possibly damaging 0.87
R4703:Evpl UTSW 11 116222505 missense probably damaging 0.98
R4947:Evpl UTSW 11 116223375 missense possibly damaging 0.88
R5243:Evpl UTSW 11 116222969 missense probably damaging 1.00
R5325:Evpl UTSW 11 116221365 missense probably damaging 1.00
R5416:Evpl UTSW 11 116234259 missense probably benign 0.13
R5580:Evpl UTSW 11 116234232 missense probably benign 0.14
R5873:Evpl UTSW 11 116234432 missense probably damaging 1.00
R6298:Evpl UTSW 11 116230922 missense probably damaging 1.00
R6438:Evpl UTSW 11 116230101 missense probably benign 0.00
R6742:Evpl UTSW 11 116222814 missense possibly damaging 0.80
R6753:Evpl UTSW 11 116237906 missense possibly damaging 0.95
R6764:Evpl UTSW 11 116222944 missense probably damaging 0.99
R6846:Evpl UTSW 11 116223807 missense probably damaging 1.00
R7288:Evpl UTSW 11 116223949 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAACGATTGCGCAGTGAG -3'
(R):5'- AATGCTCAGAAGGCCTTCACC -3'

Sequencing Primer
(F):5'- GCAGTGAGGTGGACACTC -3'
(R):5'- TGTCACCAGGAAGAGGCTGTC -3'
Posted On2015-02-05